This document describes installation and usage of the LASTZ sequence alignment program. LASTZ is a drop-in replacement for BLASTZ, and is backward compatible with BLASTZ's command-line syntax. That is, it supports all of BLASTZ's options but also has additional ones, and may produce slightly different alignment results.
| LASTZ: | A tool for (1) aligning two DNA sequences, and (2) inferring appropriate scoring parameters automatically. | |
|---|---|---|
| Platform: | This package was developed on a Macintosh OS X system, but should work on other Unix or Linux platforms with little change (if any). LASTZ is written in C and compiled with gcc; other C compilers can probably be used by adjusting the Makefile. Some ancillary tools are written in Python, but only use modules available in typical python installations. | |
| Author: | Bob Harris <rsharris at bx dot psu dot edu> | |
| Date: | January 2010 | |
| Mailing list: | http://lists.bx.psu.edu/listinfo/lastz-users |
A packed archive containing source code for LASTZ is available from the Miller Lab at Penn State.
If you have received the distribution as a packed archive, unpack it
by whatever means are appropriate for your computer. The result should be
a directory <somepath>/lastz‑distrib‑X.XX.XX that contains
a src subdirectory (and some others). You may find it convenient
to remove the revision number (‑X.XX.XX) from the directory name.
Before building or installing any of the programs, you will need to tell the
installer where to put the executable, either by setting the shell variable
$LASTZ_INSTALL, or by editing the make‑include.mak
file to set the definition of installDir. Also, be sure to add
the directory you choose to your $PATH.
Then to build the LASTZ executable, enter the following commands from bash
or a similar command-line shell (Solaris users should substitute
gmake for make). This will build two executables
(lastz and lastz_D) and copy them into your
installDir.
cd <somepath>/lastz-distrib-X.XX.XX/src
make
make install
The two executables are basically the same program; the only difference is
that lastz uses integer scores, while lastz_D uses
floating-point scores.
A simple self test is included so you can test whether the build succeeded. To run it, enter the following command:
make test
If the test is successful, you will see no output from this command.
Otherwise, you will see the differences between the expected output and the
output of your build, plus a line that looks like this:
make: *** [test] Error 1
LASTZ is designed to preprocess one sequence or set of sequences (which we collectively call the target) and then align several query sequences to it. The general flow of the program is like a pipeline: the output of one stage is the input to the next. The user can choose to skip most stages via command-line options; any stages that are skipped pass their input along to the next stage unchanged. Two of the stages, scoring inference and interpolation, are special in that they perform a miniature version of the pipeline within them.
Note that the following discussion is a generalization, intended to describe the basic idea of LASTZ's operation. There are many exceptions that depend on the particular options specified.
The stages are:
The usual flow is as follows (though most of these steps are optional,
and some settings like ‑‑anyornone
may affect the processing order).
We first read the target sequence(s) into memory, and use that to build a seed
word position table that will allow us to quickly map any word in the target to
all of the positions where it appears. (For the purposes of this discussion
you can think of a word as a 12-mer of DNA.) Then we read each
query sequence in turn, processing them more or less independently. We examine
the word starting at each base in the query and use the position table to find
matches, called seeds, in the target. The seeds are extended to
longer matches called HSPs (high-scoring segment pairs) and filtered
based on score. The HSPs are chained into the highest-scoring set of syntenic
alignments, and then reduced to single locations called anchors.
The anchors are then extended to local alignments (which may contain
gaps) and again filtered by score, followed by back-end filtering to discard
alignment blocks that do not meet specified criteria for certain traits. We
then interpolate, repeating the entire process at a higher sensitivity in the
holes between the alignment blocks. And finally, we write out the alignment
information to a file. Then these steps are repeated with the reverse
complement of the query sequence, before moving on to the next sequence in the
query file.
The scoring inference stage is not usually performed. Typically it is used only when sequences for new species are acquired, to create scoring files for subsequent alignments of those species.
For those eager to try it out, here are some illustrative examples to get you started. Detailed reference material begins with the next section.
It is often adequate to use a lower sensitivity level than is achieved with LASTZ's defaults. For example, to compare two complete chromosomes, even for species as distant as human and chicken, the alignment landscape is evident even at very low sensitivity settings. This can speed up the alignment process considerably.
This example compares human chromosome 4 to chicken chromosome 4. These sequences can be found in the downloads section of the UCSC Genome Browser, and are 191 and 94 megabases long, respectively. To run a quick low-sensitivity alignment of these sequences, use a command like this:
lastz hg18.chr4.fa galGal3.chr4.fa \
--notransition --step=20 --nogapped \
--format=maf > hg18_4_vs_galGal3_4.maf
This runs in about two and a half minutes on a 2-GHz workstation, requiring
only 400 Mb of RAM. Figure 1(a) shows the results, plotted using the
‑‑format=rdotplot output option and
the R statistical package.
(When in MAF format, LASTZ output can be browsed with
the GMAJ interactive viewer for multiple alignments, available from the
Miller Lab at Penn State.)
Using ‑‑notransition lowers
seeding sensitivity and reduces runtime (by a factor of about 10 in this case).
‑‑step=20 also lowers seeding
sensitivity, reducing runtime and also reducing memory consumption (by a factor
of about 3.3 in this case).
‑‑nogapped eliminates the
computation of gapped alignments. The complete alignment process using default
settings (shown in Figure 1(b)) uses 1.3 Gb of RAM and takes 4.5 hours on a
machine running at 2.83 GHz.
|
Figure 1(a)
|
Figure 1(b)
|
Short read mapping for close species requires parameters very different from
LASTZ's defaults. This example compares a simulated set of primate shotgun
reads to human chromosome 21. The chromosome can be found in the downloads
section of the UCSC Genome Browser
(it is about 47 megabases). Ten thousand simulated reads were generated by
extracting 60-bp intervals from chimp chr21, subjecting them to mild mutation
(including short gaps), and then truncating them to 50 bp (these are included
in the LASTZ distribution, in test_data/fake_chimp_reads.2bit).
To see where these reads map onto the human chromosome, use this command:
lastz hg18.chr21.fa[unmask] fake_chimp_reads.2bit \
--step=10 --seed=match12 --notransition --exact=20 --noytrim \
--match=1,5 --ambiguous=n \
--coverage=90 --identity=95 \
--format=general:name1,start1,length1,name2,strand2 \
> hg18_21_vs_reads.dat
Attaching [unmask] to the chromosome
filename instructs LASTZ to ignore masking information and treat repeats the
same as any other part of the chromosome, in order to accurately assess the
uniqueness of the read mappings. Since we know the two species are close, we
want to reduce sensitivity. Using
‑‑step=10, we will only be looking for
seeds at every 10th base. Instead of the default seed pattern, we use
‑‑seed=match12 and
‑‑notransition so our
seeds will be exact matches of 12 bases. Instead of the default
x-drop extension method we use
‑‑exact=20 so that a 20-base
exact match is required to qualify as an HSP. Because we are aligning short
reads, we specify
‑‑noytrim so the alignment ends will
not be trimmed back to the highest scoring locations during gapped extension.
We replace the default score set, which is for more distant species, with the
stricter ‑‑match=1,5. This scores
matching bases as +1 and mismatches as −5. We also use
‑‑ambiguous=n so that Ns
will be scored appropriately.
We are only interested in alignments that involve nearly an entire read, and
since the species are close we don't want alignments with low identity;
therefore we use ‑‑coverage=90 and
‑‑identity=95.
For output, we are only interested in where the reads align, so we use the
‑‑format=general option and specify
that we want the position on the chromosome (name1,
start1, length1) and the read name and orientation
(name2, strand2). This creates a tab-delimited
output file with one line per alignment block, a format that is well-suited for
downstream processing by other programs. For example, to count the number of
different reads we've mapped, we can run this Unix shell command:
cat hg18_21_vs_reads.dat | grep -v "#" | awk '{print $4}' | sort -u | wc
This example demonstrates the primary
alignment processing stages, using the
α-globin regions of cow and human. This data is included in the LASTZ
distribution in test_data/aglobin.2bit, and consists of a 70K bp
segment of human DNA and a 66K bp segment of cow DNA. We will follow this
example through the major stages of seeding, gap-free extension, chaining, and
gapped extension.
Figure 2(a) shows the result of default seeding on a small window (3K bp) in the middle of these segments. Seeds are short near-matches; in this case each seed is 19 bp and could have as many as 8 mismatches (12-of-19 with one transition). There are 338 seeds in this window, but regions where there are many seeds are indistinguishable from line segments.
Figure 2(b) shows high-scoring segment pairs, the result of gap-free extension of the seeds. There are 11 HSPs (only 10 are apparent in the figure, but one of those is split by a 1-bp shift to the next diagonal). Note that many seeds were discarded because their extensions were low scoring or overlapped.
Figure 2(c) shows the local alignment blocks resulting from gapped extension of the HSPs. There are four alignment blocks.
Then we zoom out and show the results for the full sequences; the red box indicates the small region shown in the earlier figures. Figure 2(d) shows the HSPs, 2(e) shows the gapped alignment blocks, and 2(f) illustrates how chaining reduces the alignment blocks to a single syntenic line (or two lines, if there were matches on both strands). Note that one can already tell quite a bit about how the sequences align just from looking at the HSPs.
|
Figure 2(a)
|
Figure 2(b)
| |||
|
Figure 2(c)
|
Figure 2(d)
| |||
|
Figure 2(e)
|
Figure 2(f)
|
When a sequence is aligned to itself, the full result will contain mirror-image copies of each alignment block. It is computationally wasteful to process both copies. LASTZ can handle this situation in four different ways.
‑‑notrivial
option. This performs the full computation on both copies, but doesn't report
the trivial self-alignment block along the main diagonal (Figure 3(b)).
‑‑self option in place
of the query sequence. LASTZ will save work by computing with only one block
of each mirror-image pair, though it still reports both copies in the output by
reconstructing the second copy from the first. It also invokes
‑‑notrivial automatically to omit the trivial self-alignment block
along the main diagonal. This gives the same output as the previous method,
but runs faster (Figure 3(c)).
‑‑self in place of the
query, and also add the ‑‑nomirror
option. In this case LASTZ reports only one copy of each mirror-image pair,
as well as omitting the trivial block (Figure 3(d)).
In the following figure, we suppose we have a sequence with repeated motifs, in the order α1 β1 γ1 β2 δ1 α2 δ2′ γ2. That is, α1 and α2 are ancient duplications, as are β1 and β2, and γ1 and γ2. δ2′ is an inversion, a reverse-complement duplicate of δ1.
|
Figure 3(a)
|
Figure 3(b)
| |||
|
Figure 3(c)
|
Figure 3(d)
|
If you are familiar with BLASTZ, you can run LASTZ the same way you ran BLASTZ, with the same options and input files. In addition to this BLASTZ compatibility, LASTZ provides other options.
The general format of the LASTZ command line is
lastz <target> [<query>] [<options>]
The angle brackets <> indicate meta-syntactic variables that
should be replaced with your values, while the square ones []
indicate elements that are optional. Spaces separate fields on the command
line; a field that needs to contain a space (e.g. within a file name) must be
enclosed in double quotes "". Elements can appear in
any order, the only constraint being that, if present, the
<query> must appear after the <target>.
Output is generally written to stdout, unless specified otherwise
for a particular option.
The <target> and <query> are usually
just the names of files containing the sequences to be aligned, in either
FASTA, Nib,
or 2Bit format. However they can be
HSX index files that refer to the sequences indirectly,
and they also can specify pre-processing actions such as selecting a
subsequence from the file (see Sequence Specifiers for
details). With certain options such as
‑‑self the <query>
is not needed; otherwise if it is left unspecified the query sequences are read
from stdin
(though this does not work with random-access formats
like 2Bit).
As a special case, the <target> is
omitted when the ‑‑targetcapsule
option is used, since the target sequence is embedded within the capsule file.
For options, the general format is ‑‑<keyword> or
‑‑<keyword>=<value>, but for BLASTZ compatibility
some options also have an alternative syntax
<letter>=<number>.
(Be careful when copying options from the tables below, as some of the hyphens
here are special characters to avoid awkward line wrapping in certain web
browsers. If you have trouble, replace the pasted hyphens with ordinary typed
ones on your command line.)
Please understand that LASTZ is a complex program and its options are not all independent, i.e., some options are not valid in combination with certain others. It would be difficult and cumbersome to attempt to list every possible conflict here; instead we just mention some of the major ones. If you are not sure about a particular combination, go ahead and try it — LASTZ will tell you if it's not allowed.
Running the command lastz without any arguments prints a help
message with the most commonly used options, while running
lastz --help
lists all of the options.
| Option | BLASTZ equivalent | Meaning |
--strand=both |
B=2 |
Search both strands. |
--strand=plus |
B=0 |
Search the forward strand only (the one corresponding to the query specifier). |
--strand=minus |
Search only the reverse complement of the query specifier. | |
--self |
Perform a self-alignment: the target sequence is also the query. Computation is more efficient than it would be without this option, since only one of each mirror-image pair of alignment blocks is processed (the other, redundant one is skipped during processing, but re-created in the output). Also, the trivial self-alignment block along the main diagonal is omitted from the output. This option cannot be used if the target is comprised of multiple sequences. | |
--nomirror |
Inhibit the re-creation of mirror-image alignments. Output consists of only
one copy of each meaningful alignment block in a self-alignment. This option
is only applicable when the ‑‑self
option is used.
|
|
--anyornone |
Stop processing after the first qualifying alignment has been found and written to the output, and move on to the next query. "Qualifying" means an alignment that meets all of the thresholds, etc. set by other options as usual. See Any-or-None Alignment for more details. This option is not compatible with chaining or interpolation. | |
| Defaults: |
By default both strands are searched, and the target is assumed to be different
from the query.
If |
These are fundamental parameters for alignment scoring, used in several of the stages.
| Option | BLASTZ equivalent | Meaning | ||||||||||||||||||||||||||
--scores=<scoring_file> |
Q=<file> |
Read the substitution scores and gap penalties (and possibly other options) from a scoring file. This option cannot be used in conjunction with ‑‑match or inference. | ||||||||||||||||||||||||||
--match=<reward>[,<penalty>] |
Set the score values for a match (+<reward>)
and mismatch (−<penalty>).
These are both specified as positive values; the "+" and "−" are
implicitly assumed. When <penalty> is not specified,
it is the same as <reward>.
Note that specifying
This option cannot be used in conjunction with
|
|||||||||||||||||||||||||||
--gap=[<open>,]<extend> |
O=<open>E=<extend> |
Set the score penalties for opening and extending a gap. These are specified
as positive values; subtraction is implicitly assumed. Note that the first
base in a gap incurs the sum of both penalties.
This option is only valid if gapped extension is
being performed, and cannot be used in conjunction with
|
||||||||||||||||||||||||||
--ambiguous=n |
Treat each N in the input sequences as an ambiguous nucleotide.
Substitutions with N are scored as zero, instead of using the
fill_score value from the scoring file
(which is -100 by default). See
Non-ACGT Characters for a more thorough discussion.
This option is not valid with quantum DNA.
|
|||||||||||||||||||||||||||
--ambiguous=iupac |
Treat each of the IUPAC-IUB ambiguity codes (B, D, H, K, M, R, S, V, W,
Y as well as N) in the input sequences as a
completely ambiguous nucleotide. Substitutions with these characters
are scored as zero, instead of using the fill_score value from the
scoring file (which is -100 by default). See
Non-ACGT Characters for a more thorough discussion.
This option is not valid with quantum DNA.
Note that this does not mean that LASTZ considers the specific
ambiguity that is associated with each character (e.g. that |
|||||||||||||||||||||||||||
--infer[=<control_file>] |
Infer substitution scores and/or gap penalties from the sequences, then use
them to align the sequences. Parameters controlling the inference process are
read from the control file.
This feature is somewhat experimental, and special builds of LASTZ are required
to enable it. Please see Inferring Score Sets for
more information. Inference cannot be used in conjunction with
‑‑scores,
‑‑match, or
‑‑gap.
|
|||||||||||||||||||||||||||
--inferonly[=<control_file>] |
Infer substitution scores and/or gap penalties, but don't perform the final
alignment (requires ‑‑infscores).
|
|||||||||||||||||||||||||||
--infscores[=<output_file>] |
Save the inferred scoring parameters to the specified file (or to
stdout), in the same format expected
by ‑‑scores.
|
|||||||||||||||||||||||||||
| Defaults: |
By default the HOXD70 substitution scores are used
(see [Chiaromonte 2002] for an explanation of
how this scoring matrix was determined).
Default gap penalties are determined as follows. If
By default, a run of |
| Option | BLASTZ equivalent | Meaning |
--step=<offset> |
Z=<offset> |
Offset between the starting positions of successive target words considered for potential seeds. (But this does not apply to the query words, which always use a step size of 1.) |
--maxwordcount=<limit> |
Words occurring more often than <limit> in the target are
not eligible for seeds. Specifically, after the target seed word position table
is built, any words exceeding this count are removed from the table.
|
|
--maxwordcount=<limit>% |
Set maxwordcount to keep a specified percentage of seed word
positions. <limit> is a lower bound on the percentage of
words to be kept (0 < limit < 100).
Setting this as a percentage makes it easier to maintain consistency across
runs. The actual count is dependent on sequence length and composition as
well as the step offset and seed pattern. For example, Figure 4
shows the variation among human chromosomes in hg18 for
Figure 4
|
|
--masking=<count> |
M=<count> |
Dynamically mask the target sequence by excluding any positions that appear
in too many alignments from further consideration for seeds.
Specifically, a cumulative count is maintained of the number of times each
target location is aligned. After each query sequence is processed, any
locations that have been output in at least
This option requires one byte of memory for each target location. The maximum
value allowed for |
--targetcapsule=<capsule_file> |
The target seed word position table and seed (as well as the target sequence)
are read from the specified file. When this option
is used, the normal target specifier is omitted from the command line, and the
following options are not allowed:
‑‑step,
‑‑maxwordcount,
‑‑masking,
‑‑seed,
‑‑word.
|
|
--segments=<segment_file> |
Read anchor segments from a file, instead of discovering them via seeding. This replaces any other options related to indexing, seeding, gap-free extension or chaining. Those stages are skipped, and processing begins with the gapped extension stage. | |
| Defaults: | By default a step of 1 is used, no words are removed from the target seed word position table, dynamic masking is not performed, and no target capsule or segment file is used. |
| Option | BLASTZ equivalent | Meaning |
--seed=12of19 |
T=1 or T=2 |
Seeds require a 19-bp word with matches in 12 specific positions
(1110100110010101111).
|
--seed=14of22 |
T=3 or T=4 |
Seeds require a 22-bp word with matches in 14 specific positions
(1110101100110010101111).
|
--seed=match<length> |
W=<length> |
Seeds require a <length>-bp word with matches in all
positions.
|
--seed=half<length> |
Seeds require a <length>-bp word with matches or transitions
in all positions. This option is not valid with
quantum DNA.
|
|
--seed=<pattern> |
Specifies an arbitrary pattern of 1s, 0s, and
Ts for seed discovery. (Note that Ts are not valid
with quantum DNA.)
|
|
--transition |
T=1 or T=3 |
In each seed, allow any one match position to be a transition instead. This option is not valid with quantum DNA. |
--transition=2 |
In each seed, allow any two match positions to be transitions instead. This option is not valid with quantum DNA. | |
--notransition |
T=2 or T=4 |
Don't allow any match positions in seeds to be satisfied by transitions. |
--filter=[<transv>,]<matches> |
Filter the resulting seeds, requiring at least <matches>
exact matches and allowing no more than <transv>
transversions. If <transv> is not specified, any number
of transversions is allowed (they are not limited).
This option is not valid with quantum DNA.
|
|
--nofilter |
Don't filter seeds. | |
--ball=<score> |
Set the quantum seeding threshold, the minimum score required of a DNA word to be included in the seeding ball. | |
--ball=<percentage>% |
Set the quantum seeding threshold as a percentage of the maximum word score possible. | |
--twins=[<minsep>..]<maxsep> |
Require two nearby seeds on the same diagonal, separated by a number of bases
in the given range. See the Seed Patterns section
for more information. This option cannot be used in conjunction with
‑‑recoverseeds.
|
|
--notwins |
Allow single, isolated seeds. | |
--recoverseeds |
Avoid losing seeds in hash collisions. This will slow the alignment process
considerably and cost more memory, and usually does not improve the results
significantly. See the Gap-free Extension stage
for more information. This option cannot be used in conjunction with
‑‑twins.
|
|
--norecoverseeds |
Ignore hash collisions, at the expense of missing some seeds. Note that missing seeds usually does not mean missing alignments, since most alignable regions have many seed hits. | |
| Defaults: |
By default the 12-of-19 seed is used, one transition is allowed (except with
quantum DNA), the hits are not filtered, twins are not
required, and hash collisions are not recovered.
If the |
| Option | BLASTZ equivalent | Meaning |
--gfextend |
Perform gap-free extension of seeds to HSPs (high scoring segment pairs), according to the other options in this section. | |
--nogfextend |
Skip the gap-free extension stage, passing the seeds along to the next specified stage. | |
--exact=<length> |
Find HSPs using the exact match extension method with the given length threshold, instead of using the x-drop method. | |
--mismatch=<count>,<length> |
Find HSPs using the mismatch extension method with the given length threshold
and allowing count mismatches, instead of using the x-drop method.
|
|
--xdrop=<dropoff> |
X=<dropoff> |
Find HSPs using the x-drop extension method with the given termination threshold, instead of using the exact match method. The dropoff setting determines the endpoints of each gap-free segment: the extension of each seed is stopped when its cumulative score drops off by more than the given threshold from the maximum seen so far. See the Gap-free Extension stage for more details. |
--hspthresh=<score> |
K=<score> |
Set the score threshold for the x-drop extension method; HSPs scoring lower are discarded. |
--hspthresh=top<basecount> |
Set an adaptive score threshold for the x-drop
extension method; HSPs scoring lower are discarded. The score threshold is
chosen to limit the number of target sequence bases in HSPs to about
<basecount>
(or possibly a little higher in case of ties, etc.).
|
|
--hspthresh=top<percentage>% |
Set an adaptive score threshold for the x-drop
extension method; HSPs scoring lower are discarded. The score threshold is
chosen to limit the number of target sequence bases in HSPs to about
<percentage> percent of the target (or possibly a little
higher in case of ties, etc.).
|
|
--entropy |
P=1 |
Adjust for entropy when qualifying HSPs in the x-drop extension method. Those that score just slightly above the HSP threshold are adjusted downward according to the entropy of their nucleotides, and any that then fall below the threshold are discarded. |
--entropy=report |
P=2 |
Adjust for entropy when qualifying HSPs in the x-drop extension method,
and report (to stderr) any HSPs that are discarded as a result.
|
--noentropy |
P=0 |
Don't adjust for entropy when qualifying HSPs. |
| Defaults: |
By default seeds are extended to HSPs using x-drop extension, with entropy
adjustment.
If
If |
| Option | BLASTZ equivalent | Meaning |
--chain |
C=1 or C=2 |
Perform chaining of HSPs with no penalties. |
--chain=<diag>,<anti> |
C=1 or C=2G=<diag>R=<anti> |
Perform chaining with the given penalties for diagonal and anti-diagonal in the DP matrix. These are specified as positive values; subtraction from the score is implicitly assumed. |
--nochain |
C=0 or C=3 |
Skip the chaining stage. |
| Defaults: | By default the chaining stage is skipped. |
| Option | BLASTZ equivalent | Meaning |
--gapped |
C=0 or C=2 |
Perform gapped extension of HSPs (or seeds, if gap-free extension is not performed), after first reducing them to anchor points. |
--nogapped |
C=1 or C=3 |
Skip the gapped extension stage. (This means that interpolation must also be skipped, since it is not allowed without gapped extension.) |
--ydrop=<dropoff> |
Y=<dropoff> |
Set the threshold for terminating gapped extension; this restricts the endpoints of each local alignment by limiting the local region around each anchor in which extension is performed. The boundary of this region in the DP matrix is formed by the points where the cumulative score has dropped off by more than the given threshold from the maximum seen so far. See the Gapped Extension stage for more details. |
--noytrim |
If y-drop extension encounters the end of the sequence, extend the alignment to the end of the sequence rather than trimming it back to the location giving the maximum score. This is highly recommended when either the target or query sequences are short reads (say, less than 100 bases), to prevent y-drop mismatch shadow. | |
--gappedthresh=<score> |
L=<score> |
Set the threshold for gapped extension; alignments scoring lower than
<score> are discarded.
When used along with the x-drop method for gap-free extension, this value is
generally set at least as high as the HSP threshold. Setting it lower has no
effect, since at worst the HSP itself would always qualify (both extension
stages use the same scoring matrix).
|
--allgappedbounds |
Revert to handling bounding alignments the way they were handled in BLASTZ. This is discussed in Bounding Alignments in the DP Matrix. | |
| Defaults: |
By default gapped extension is performed, and alignment ends are trimmed
to the locations giving the maximum score.
If
The default for the gapped score threshold is to use the same value as the
HSP threshold (which is settable via
|
| Option | BLASTZ equivalent | Meaning |
--identity=<min>[..<max>] |
Filter alignments by their percent identity,
0 ≤ min ≤ max ≤ 100 percent.
Identity is the percentage of aligned bases that
are matches. Alignment blocks outside the given range are discarded.
This option is not valid with quantum DNA.
|
|
--continuity=<min>[..<max>] |
Filter alignments by how much of the input sequence aligns as matches or
mismatches, rather than gaps,
0 ≤ min ≤ max ≤ 100 percent.
Continuity is the percentage of alignment
columns that are not gaps. Alignment blocks outside the given range
are discarded.
|
|
--coverage=<min>[..<max>] |
Filter alignments by how much of the input sequence they cover,
0 ≤ min ≤ max ≤ 100 percent.
Coverage is the percentage of the entire target
or query sequence (whichever is shorter) that is included in the alignment
block. Blocks outside the given range are discarded.
|
|
--matchcount=<min> |
Filter alignments by how many bases match,
0 ≤ min bases.
Match count is the number of matched bases
in the alignment. This option is not valid with
quantum DNA.
|
|
--notrivial |
Do not output a trivial self-alignment block if the target and query sequences
are identical. Note that using ‑‑self
automatically enables this option.
|
|
| Defaults: | By default no back-end filtering is performed, and the trivial block is included if the sequences happen to be identical. |
| Option | BLASTZ equivalent | Meaning |
--inner=<score> |
H=<score> |
Perform additional alignment between the gapped alignment blocks, using
(presumably) more sensitive alignment parameters. <score>
is used as the threshold for both the gap-free and gapped extension sub-stages;
see the discussion of interpolation for more
details.
This option is only valid if gapped extension is performed. |
| Defaults: | By default interpolation is not performed. |
| Option | BLASTZ equivalent | Meaning |
--output=<output_file> |
Write the alignments to the specified file name instead of stdout.
|
|
--format=<type> |
Specifies the output format:
lav,
lav+text,
axt,
axt+,
maf,
maf+,
maf-,
sam,
softsam,
sam-,
softsam-,
cigar,
differences,
rdotplot,
text,
general[:<fields>],
or
general-[:<fields>].
|
|
--rdotplot=<file> |
Create an additional output file suitable for plotting the alignment blocks
with the R statistical package. The
output file is the same as would be produced by
‑‑format=rdotplot, but this option
allows you to create the dotplot file without having to run the alignment twice.
|
|
--markend |
Just before normal completion, write a marker line
to the output file. This option can be useful with pipelines or batch servers,
where there may be a question as to whether or not LASTZ completed successfully.
Note that in some output formats this marker is not a legal line, in which case
you must remove it before any downstream processing.
|
|
--census[=<output_file>] |
c=1 |
Count and report how many times each target base aligns, up to 255.
Ns are included in the count (both bases that are Ns
and bases aligning to Ns), and even bases aligning to gaps are
counted. Requires one byte of memory for each target location.
For any of the |
--census16[=<output_file>] |
Count and report how many times each target base aligns, up to ≈65 thousand. Requires two bytes of memory for each target location. | |
--census32[=<output_file>] |
Count and report how many times each target base aligns, up to ≈4 billion. Requires four bytes of memory for each target location. | |
--nocensus |
c=0 |
Do not report a census of aligning bases. |
--tableonly |
Just write out the target seed word position table and quit; don't search for seeds or perform any subsequent stages. | |
--tableonly=count |
Just write out the target word count table and quit; don't search for seeds or perform any subsequent stages. | |
--writecapsule=<capsule_file> |
Just write out a target capsule file and quit; don't search for seeds or perform any subsequent stages. The capsule file contains the target sequence, the seed, the target seed word position table, and other related information. | |
--writesegments=<segment_file> |
Write out alignments as segments, in the same format
used for input by the ‑‑segments
option. These anchor segments can then be used to anchor alignments
in a subsequent run of LASTZ. This can be useful if you want to filter HSPs in
some way before performing gapped extension, for example filtering them by
length. Since anchor segments must be gap-free, this option cannot be used in
conjunction with gapped extension.
|
|
--progress[=<N>] |
|
Report the count and name of every Nth query to stderr, as
processing begins on that query. If N is omitted, every query is reported.
|
| Defaults: |
By default alignments are written to stdout in lav
format, no census is reported, and no target table or capsule is written out.
|
There are several shortcut options to support the
Yasra mapping assembler. These
provide canned sets of option settings that work well for aligning an assembled
reference sequence (as the target) with a set of shotgun reads (as the query).
They are selected based on the expected level of identity between the sequences.
For example, ‑‑yasra90 should be used when we expect 90% identity.
The ‑‑yasraXXshort options are appropriate when the reads are very
short (less than 50 bp).
| Option | Equivalent |
--yasra98 |
T=2 Z=20 ‑‑match=1,6 O=8 E=1 Y=20 K=22 L=30 ‑‑identity=98
|
--yasra95 |
T=2 Z=20 ‑‑match=1,5 O=8 E=1 Y=20 K=22 L=30 ‑‑identity=95
|
--yasra90 |
T=2 Z=20 ‑‑match=1,5 O=6 E=1 Y=20 K=22 L=30 ‑‑identity=90
|
--yasra85 |
T=2 ‑‑match=1,2
O=4 E=1 Y=20 K=22 L=30 ‑‑identity=85
|
--yasra75 |
T=2 ‑‑match=1,1
O=3 E=1 Y=20 K=22 L=30 ‑‑identity=75
|
--yasra95short |
T=2 ‑‑match=1,7
O=6 E=1 Y=14 K=10 L=14 ‑‑identity=95
|
--yasra85short |
T=2 ‑‑match=1,3
O=4 E=1 Y=14 K=11 L=14 ‑‑identity=85
|
| Option | Meaning |
--version |
Report the program version and quit. |
--help |
List all options. |
--help=files |
Describe the syntax for sequence specifiers. |
--help=formats |
Describe the available output formats. |
--help=shortcuts |
List BLASTZ-compatible shortcuts. |
--help=yasra |
List Yasra-specific shortcuts. |
A target or query sequence specifier normally just indicates a file to be used in the alignment; however various pre-processing actions can also be specified. These are performed as the sequences are read from the file, and may include selecting a particular sequence and/or subrange, masking, adjusting sequence names, etc.
The format of a sequence specifier is
<file_name>[[<actions>]]*
The <file_name> field is required; the actions list is
optional. Note that the <actions> are enclosed in literal
square brackets (in addition to the meta ones that just indicate they are
optional), and consist of a comma-separated list (with no spaces), e.g.
[action1,action2,...]. The * indicates that
several action lists can be appended; they are treated the same as if they were
in a single list.
Note that the actions apply to every sequence in the file. For example, if you
specify a subrange of, say, [100..], you will skip the first 99 bp
in every sequence.
The following actions are supported:
| Action | Meaning |
<subrange> |
Only a subrange of the sequence is processed. The usual form of a subrange
is [<start>]..[<end>]. Either
<start> or <end> can be omitted, in which
case the start or end of the sequence is used. Subrange indices begin with 1
and are inclusive
(i.e., they use the origin-one, closed position
numbering system). For example, 201..300 is a 100-bp subrange
that skips the first 200 bp in the sequence.
For BLASTZ compatibility, the alternative syntax
Another useful syntax for this is
Additionally, if a subrange has Note that subrange positions are always measured from the start of the sequence provided in the file (i.e., counting along the forward strand), even if the sequence is being reverse complemented. |
multiple |
The file's sequences are internally treated as a single sequence. This action is required when the target (not the query) is comprised of multiple sequences. |
subset=<names_file> |
The name of a file containing a list of desired
sequence names; only these sequences will be processed. The names can be
piped in by specifying /dev/stdin as the file. This action is
only valid for FASTA, 2Bit,
or HSX input files.
|
subsample=<k>/<n> |
Process only the kth sequence of every group of n
sequences. k ranges from 1 to n. This action is
only valid for FASTA, 2Bit,
or HSX input files.
|
unmask |
Convert any lowercase bases to uppercase. Lowercase bases usually indicate instances of biological repeats, and are excluded from the seeding stage of the alignment process. |
softmask=<mask_file> |
Mask the segments specified in
<mask_file> by replacing them with
lowercase equivalents. Lowercase bases usually represent instances of
biological repeats, and are excluded from the seeding stage of the alignment
process but not from later stages.
Note that soft masking is performed after any unmasking.
|
softmask=keep:<mask_file> |
Mask the segments not specified in
<mask_file> by replacing them with
lowercase equivalents. Any base not in one of the specified intervals
is replaced, and thereby excluded from the seeding stage (but not later stages)
of the alignment process.
|
xmask=<mask_file> |
Mask the segments specified in
<mask_file> by replacing them with
Xs. (Note that this always masks with actual Xs,
even if the scoring file specifies a different
character as "bad".) See Non-ACGT Characters for
information on how Xs affect the alignment process.
|
xmask=keep:<mask_file> |
Mask the segments not specified in
<mask_file> by replacing them with
Xs. Any base not in one of the specified intervals is
replaced.
|
nmask=<mask_file> |
Mask the segments specified in
<mask_file> by replacing them with
Ns. See Non-ACGT Characters for
information on how Ns affect the alignment process.
|
nmask=keep:<mask_file> |
Mask the segments not specified in
<mask_file> by replacing them with
Ns. Any base not in one of the specified intervals is
replaced.
|
nameparse=full |
Report full sequence names in the output, instead of short names. As described in Sequence Name Mangling, LASTZ normally shortens FASTA and 2Bit sequence names in an attempt to include only the distinguishing core of the name. This action is provided in case LASTZ's choice of names is not helpful. It is only valid for FASTA or 2Bit sequence files. |
nameparse=darkspace |
Extract the first word from the sequence header line, keeping only a non-whitespace string. If the first word is a filename, any directory/folder information is discarded. See Sequence Name Mangling for more information on how the name used for output is derived. This action is currently only valid for FASTA or 2Bit sequence files. |
nameparse=alphanum |
Extract the first word from the sequence header line, keeping only an alphanumeric string. If the first word is a filename, any directory/folder information is discarded; then the name is truncated at the first character that is not a letter, digit, or underscore. See Sequence Name Mangling for more information on how the name used for output is derived. This action is currently only valid for FASTA or 2Bit sequence files. |
nameparse=tag:<marker> |
Use the specified marker to extract a short name from the sequence header line.
For example, nameparse=tag:foo will look for the string
foo in the header line, and copy the name from the text following
that, up to the next non-alphanumeric character. See
Sequence Name Mangling for more information on how
the name used for output is derived. This action is only valid for
FASTA or 2Bit sequence files.
|
nickname=<name> |
Ignore any sequence names in the input file, instead using
<name> in the output. See
Sequence Name Mangling for more information on
how the name used for output is derived.
|
quantum |
The sequence contains quantum DNA.
Note that this changes the game significantly, and many of LASTZ's other
actions and options are not valid with quantum sequences. Operations such as
reverse complement, masking, special treatment of Ns and
Xs, seeding options that need to recognize
matches / transitions / transversions, and computation of percent
identity do not apply because of the arbitrary quantum alphabet and the ability
of its symbols to encode ambiguity.
|
quantum=<code_file> |
The sequence contains quantum DNA corresponding to
the specified <code_file>, which
assigns nucleotide probabilities for the quantum alphabet. These are only used
to augment the display of alignment blocks in the
Human-Readable Text output format.
|
In addition to the sequence specifier syntax shown above, LASTZ supports a more complicated syntax. This is to maintain compatibility with BLASTZ and early versions of LASTZ. All of the functionality described here can be performed using the newer syntax above.
The complete format of a sequence specifier is
[<nickname>::]<file_name>[/<select_name>][{<mask_file>}][[<actions>]][-]
As with the simpler syntax, the <file_name> field is
required; all other fields are optional. The <file_name>
and <actions> fields have the same meaning as in the simpler
syntax.
<nickname>:: is equivalent to the <name>
field in the nickname=<name> action.
/<select_name> is only valid for the
2Bit file format, and only when the file name ends with
".2bit". It specifies a single sequence from the file to use, rather than all
sequences. This is similar to the subset=<names_file>
action, except that here a single sequence name is given instead of a file of
names. Note that the name must match the mangled
sequence name extracted from the file.
{<mask_file>} is identical to the
xmask=<mask_file> action.
A - (minus sign) is equivalent to swapping the endpoints in the
<subrange> action; it causes the reverse complement of the
sequence to be used instead of the sequence itself. Again, this should be
used with care, as it can lead to murky interactions with other features.
In BLASTZ it was needed for searching only the minus strand, but LASTZ provides
a ‑‑strand option for that.
The target sequence is read at the beginning and kept in memory throughout
the run of the program. Actions such as masking, unmasking, or reverse
complement are applied when the file is read. If there are multiple sequences
in the target file, they are treated internally as one long sequence (you must
use the multiple action in the
target file's sequence specifier to enable this).
In contrast, queries are processed individually and sequentially. Each query sequence is read just before its seeding stage. The seeding through output stages are performed, comparing the query to the target. Then by default, the same stages are repeated to compare the reverse complement of the query to the target, before moving on to the next sequence in the query file.
Scoring inference is not normally performed. As described in Inferring Score Sets, LASTZ can iteratively perform the complete alignment process on the target and query, to derive a suitable scoring set. This is only available for special builds of LASTZ, and will usually be too time-consuming to perform for all sequences being aligned. The typical application is to use it once on some sample sequences from the species of interest, save the scoring file, then use that scoring file for subsequent alignments.
This pre-processing stage parses the target sequence(s) into overlapping seed words of some constant length (you can think of these as 12-mers; the actual length is determined by the seed pattern). Each word is converted to a number, called the packed seed word, according to the specified seed pattern. These (word, position) pairs are collected into the target seed word position table. Conceptually, this table is a mapping from a packed seed word to a list of the target sequence positions where that seed word occurs.
This table is one of the major space requirements of the program. Both the
memory and time required for seeding can be decreased by using sparse spacing.
The ‑‑step option sets a
step size: instead of examining every position, seed words are
stored only for multiples of the step size. Large step sizes (say,
‑‑step=100) incur a loss of sensitivity, at least at the seeding
stage. However, to discover any gapped alignment block we only need to
discover one seed (of many) in that alignment, so the actual sensitivity loss
is small in most cases. Section 6.2 of [Harris 2007]
discusses some experimental results on the effect of step size on the end
result.
The presence of biological repeats in the target and query can also be addressed during the building of the position table. A large number of repeats can adversely affect the speed of the program, by increasing the number of irrelevant alignments the program considers in the early stages. LASTZ has three techniques for dealing with repeats.
‑‑maxwordcount can be used to remove
frequently occurring target seed words from the position table before query
processing begins.
‑‑masking) can
be used to mask target positions that have occurred in too many alignments;
however this only affects subsequent query sequences.
Seeds are short near-matches between target and query sequences. They identify likely regions of homology that warrant further investigation, and serve as starting points for bootstrapping the alignment process. "Short" typically means less than 20 bp. Early alignment programs used exact matches (e.g. of length 12) as seeds, but more recent programs have used spaced seeds (these are described in more detail in the Seed Patterns section). For the purposes of this section, a seed can be thought of as a 12-mer exact match.
To locate seeds, the query sequence is parsed into seed words the same
way the target is (except that
‑‑step does not apply to the query;
we look at every seed word).
Each packed seed word is used as an index into the target seed word position
table to find the target positions that have a seed match for this
query position. Query seed words containing lower case bases are skipped, so
that repeats will not participate in the seeding stage.
A, C,
G, and T), whereas the query consists of symbols from
an arbitrary alphabet. The quantum sequence is parsed into seed words as
before, but instead of a direct lookup, each word, called a q-word,
is first converted to a quantum seeding ball of those DNA words that
are most similar to it. Similarity is determined by the scoring matrix; all
words with a combined substitution score above the quantum seeding threshold
(set by the ‑‑ball option) are
considered to be in the ball. Then each word in the ball is looked up in the
target seed word position table as usual, with all such hits considered to be
seed matches for the q-word.
The quantum seeding threshold can also be set as a percentage of the maximum
word score possible. If an exact match seed is used, the maximum word score is
the highest value in the substitution matrix multiplied by the seed length. If
a spaced seed is used, the multiplier is the number of 1 positions
in the pattern.
Note that the seeding options that provide
special treatment for transitions (Ts in the seed pattern,
half-weight seeds, allowing one or two match positions to be transitions, etc.)
are not supported for quantum alignments. These options would make
the quantum seeding procedure more complex, and are not really necessary
because the quantum mechanism itself provides an alternative way to increase
the alignment sensitivity. Also note that q-words containing lower case bases
are not discarded, since the quantum alphabet is arbitrary and many
ASCII bytes do not even have upper/lowercase versions.
In this stage, each seed is extended without allowing gaps to determine whether it is part of a high-scoring segment pair (HSP). The seed is extended along its DP matrix diagonal independently in both directions according to an extension rule, currently either exact match, M-mismatch, or x-drop.
Exact match extension (‑‑exact) simply
extends the seed until a mismatch is found. If the resulting length is enough,
the extended seed is kept as an HSP for further processing. Exact match
extension is most useful when the target and query are expected to be very
similar, e.g. when aligning short reads to a similar reference genome.
M-mismatch extension
(‑‑<M>mismatch) extends the
seed to find the longest interval that includes the entire seed and contains
no more than M mismatches. If the resulting length is enough,
the extended seed is kept as an HSP for further processing. M-mismatch
extension is most useful when the approximate divergence between the target
and query is known, and HSPs of a known length are desired.
It provides a way to specify both length and identity thresholds together,
with more flexibility than ‑‑exact.
In x-drop extension (‑‑xdrop), as we
extend in each direction we track the cumulative score for the extended match
according to the substitution scoring matrix. The extension is stopped when
the score drops off by more than the given x-drop threshold; that is, when the
difference between the peak score seen so far and the current score is more
than <dropoff>.
(Another way to think of it is that the segment ends when a section scoring
worse than −<dropoff> is encountered.)
The extension is then trimmed back to the peak point. If the combined score
of the seed plus both extensions meets the threshold set by the
‑‑hspthresh option, it qualifies
as an HSP and is kept for further processing. Matches that do not meet the
score threshold are discarded.
The ‑‑entropy options control
whether or not the scores are adjusted for nucleotide entropy when they are
compared to the threshold.
‑‑hspthresh=top<basecount>
and
‑‑hspthresh=top<percentage>%)
allow you to set the threshold indirectly to align the desired amount of the
target (as an approximate number of bases or as a percentage, respectively).
This way you can set it for, say, 10% (which will run quickly regardless of the
data), then examine the scores in those results and make an informed choice for
your real threshold.
‑‑recoverseeds will prevent losing
these seeds, but will slow the program significantly. Moreover, since most
true alignments contain many HSPs, with many seeds in each HSP, the vast
majority of lost seeds have no effect on the final results.
The chaining stage aims to find a series of HSPs that forms a high-scoring path through the DP matrix, aligning as much as possible while avoiding backtracking in either sequence. Conceptually it does this by examining all combinations of HSPs and scoring the chains according to the relative positions of the HSPs (e.g. the distances between them along the diagonal and anti-diagonal) as well as their individual scores. All HSPs not in the highest-scoring chain are discarded.
Ideally this process selects the "real" alignments, filtering out noise (such
as extra alignments due to repeats), and producing a set of HSPs where each
base is aligned at most once; however this is not guaranteed.
LASTZ's implementation is primarily intended for the case where elements are
known to appear in the same relative order and orientation in the query as in
the target. (However, note that because the forward and reverse strands are
processed in separate pipelines, it will not necessarily cause inversions to be
discarded.) If LASTZ's implementation of chaining is not suitable, it is
possible to substitute another chaining program by first running LASTZ with the
‑‑nogapped and
‑‑writesegments
options to get the HSPs, running a separate chaining program to filter them,
and then running the final stages of LASTZ on that output via the
‑‑segments option.
Figure 5(a) shows an alignment without chaining, while 5(b) shows the same alignment with chaining.
|
Figure 5(a)
|
Figure 5(b)
|
Before the HSPs are extended further by allowing gaps, each HSP is first reduced to a single anchor point; this allows for the possibility that the optimal alignment may include gaps within the region occupied by the HSP. The gap-free HSP is only an indication of likely homology in that vicinity; other paths through the same region that allow gaps may have a higher score, so we don't want to just extend from the ends of the HSP. Instead we run the gapped algorithm from a single point that we think is most likely to lie on the optimal path, namely the middle of the highest-scoring 31-bp interval in the HSP. A more general (and expensive) approach would be to examine all paths through the square region defined by the HSP, instead of starting from a single anchor point.
Figure 6(a) illustrates the relationship of seeds, HSPs, and anchors. Heavy lines are seeds, which were extended without gaps (see Overview) to create HSPs (thin lines). Blue dots are anchors. Seeds with no HSP shown (gray lines) had low-scoring extensions and were discarded at the gap-free extension stage.
|
Figure 6(a)
|
Figure 6(b)
|
The anchors are then processed in the order of their HSP's score (highest
first). Gapped extension is performed
independently in both directions from the anchor point, and the two resulting
alignments are joined at the anchor. If the total score meets the threshold
specified by the ‑‑gappedthresh
option, the joined alignment is kept and passed to the next stage; otherwise it
is discarded. If the extension from one anchor happens to go through one or
more other anchors, the redundant anchors are dropped from the list.
Figure 6(b) shows the relationship of anchors and their gapped extensions. The blue dots are the anchors from 6(a), which are extended in both directions to form gapped alignments (squiggly lines; the gaps are too small to be visible at this scale). One anchor had low-scoring extensions that did not meet the threshold. Another had an extension that ran directly through a nearby anchor; that anchor did not need to be processed separately.
The gapped extensions are computed using a typical
dynamic programming recurrence for affine gap alignment
(e.g. [Myers 1989] or
[Gusfield 1997]), beginning at the anchor and
terminating at the point with the highest cumulative score. The portion of
the DP matrix examined is reduced by disallowing low-scoring regions (see
[Zhang 1998]): wherever the alignment score drops
below the peak score seen so far by more than the threshold specified in the
‑‑ydrop option, the DP matrix is
truncated and no further cells are computed along that row or column.
By default the extension is then trimmed back to the location of the peak
score; thus the extension normally ends when all remaining sub-alignment
possibilities (paths in the DP matrix) begin with sections that score worse
than −<dropoff>. However for alignments
where the extension reaches the end of the sequence, you can suppress this
trimming by specifying the ‑‑noytrim
option, which is recommended when aligning short reads.
Figure 7 shows the effect of the y-drop threshold in more detail. Extension is performed in two directions from the anchor (in this example, to the upper right and lower left, because both sequences are on the positive strand). The gray region is the portion of the DP matrix explored by the extension algorithm; its boundary is formed by the points where the score dropped from the maximum by more than the y-drop threshold.
|
Figure 7
|
Whatever alignment blocks have made it through the above gauntlet are then
subjected to
identity, continuity, coverage and match count filtering (as specified by the
‑‑identity,
‑‑continuity,
‑‑coverage and
‑‑match count options,
respectively). Blocks that do not meet the specified range for each feature are
discarded.
Identity is the fraction of aligned bases (excluding columns
containing gaps or non-ACGT characters) that are
matches, expressed as a percentage. The numerator is the number of matches in
the alignment block, while the denominator is the number of matches plus the
number of mismatches.
Characters that differ only in upper vs. lower case are
counted as matches. Columns containing gaps or non-ACGT characters play no
part in this computation, and it is independent of the settings for
‑‑ambiguous=n and
bad_score. Identity cannot
be determined for alignments with quantum DNA, because
of the potential ambiguity of the symbols.
Continuity is the fraction of alignment columns that do not contain gaps, expressed as a percentage. The numerator is the number of matches plus mismatches in the alignment block, while the denominator is the number of columns.
Coverage is the fraction of bases in the entire input sequence
(target or query, whichever is shorter) that are included in the alignment
block, expressed as a percentage. Such bases are aligned in the block to
either bases or gaps in the other sequence. Note that if there are multiple
sequences in the target and/or query, only the current one is considered;
however if an input sequence is spliced with runs of Ns or
Xs, then the combination of all its subsequences (including the
splice characters between them) is considered as one input sequence, because
LASTZ does not explicitly recognize the splicing. Also note that each block's
coverage is computed independently of other blocks, and each must meet any
specified filter range by itself; blocks cannot be combined to meet coverage
requirements.
Match Count is is the number of matched bases in the alignment. Characters that differ only in upper vs. lower case are counted as matches, columns containing gaps or non-ACGT characters are not. Match count cannot be determined for alignments with quantum DNA, because of the potential ambiguity of the symbols.
Once the above stages have been performed, it is not uncommon to have regions
left over in which no alignment has been found. In the interpolation stage
(activated by the ‑‑inner option) we
repeat the seeding through gapped extension stages in these leftover regions,
at a presumably higher sensitivity. Using such high sensitivity from the
outset would be computationally prohibitive (due to the excessive number of
false, low-scoring matches), but is feasible on the smaller, leftover regions.
Another complete alignment round (seeding, gap-free extension, chaining, and gapped extension, even if some of these were skipped in the main alignment; but not back-end filtering) is performed in the small areas between the alignment blocks found in the preceding main alignment stage. Only regions within 20K bp from the endpoints of the passed-in alignment blocks are searched. Seeding for this alignment requires a 7-bp exact match with no transitions, and uses the specified scoring threshold for both its gap-free and gapped extension sub-stages. (This threshold should generally be set lower than the corresponding ones in the main alignment, in order to increase the sensitivity of the interpolation.) All other parameters are the same as those used for the main alignment stages.
Figure 8 shows the operation in more detail. The alignment blocks resulting from gapped extension are shown in 8(a) as squiggly lines. After interpolation, in 8(b), additional alignment blocks have been discovered in the red areas. Note that there are still some holes remaining, where these sequences just don't align well.
|
Figure 8(a)
|
Figure 8(b)
|
The alignment blocks found by the preceding pipeline of stages are written to
stdout (or to a file specified with the
‑‑output option) in the requested
format.
These may be seeds, gap-free HSPs, or gapped local alignments, depending on
which stages were performed. There is no particular order to the alignment
blocks for an individual query sequence (e.g. they are not sorted by
score or position). However, since the query sequences are processed serially,
the blocks for each one will appear together in the output.
LASTZ typically receives two sequence files and possibly a scoring file as inputs, and produces an alignment file as output.
DNA sequences can be provided in FASTA,
Nib, or 2Bit format, or
indirectly via an HSX index. These
sequences contain a series of A, C, G,
T, and N characters in upper or lower case.
Lower case indicates repeat-masked bases, while Ns represent
unknown bases if the ‑‑ambiguous=n
option is specified. (By default, a run of Ns or Xs
is used to separate sequences that have been catenated together for processing,
but this is now deprecated; see Non-ACGT Characters
for a discussion of the use of Ns and Xs.) As an
alternative to DNA sequence, quantum DNA using an
abstract alphabet can be used as the query
(but not as the target).
The FASTA and 2Bit formats support more than one sequence within the same file.
Files containing multiple sequences are normally only used as the query;
however invoking the multiple
action in the file's sequence specifier allows them to
be used for the target as well. Also, the
subset action allows one or more
sequences to be selected from such a file.
FASTA format stores DNA sequences as plain text. The first line begins with
a > followed by the name of the sequence, and all subsequent
lines contain nucleotide characters. The lines can be of any length.
If the file contains multiple sequences, each should start with its own
> header line.
NCBI FASTA specification
Note that although the official FASTA specification allows the character
X only in amino acid sequences, LASTZ accepts it in DNA sequences
as a splicing character. However, LASTZ does not currently support
IUPAC-IUB ambiguity codes other than N (such as R,
W, etc.),
beyond the treatment afforded by ‑‑ambiguous=iupac.
It has become common for suppliers of FASTA files to pack a plethora of additional information into a sequence's header line. This extra information can create difficulties for many sequence processing tools. For example, headers often contain spaces but file formats such as MAF do not allow spaces in sequence names. To compensate for this, LASTZ provides several options for extracting a concise name from sequence headers; see Sequence Name Mangling for details.
Nib format stores a single unnamed DNA sequence, packed as two bases per byte. UCSC Nib specification
2Bit format stores multiple DNA sequences, encoded as four bases per byte with
some additional information describing runs of masked bases or Ns.
UCSC 2Bit specification
Sequence names in 2Bit files have all the same problems as in FASTA files, so Sequence Name Mangling applies to these files as well.
A quantum DNA file describes a single sequence of "quantum" DNA, which uses
an abstract, user-defined alphabet. Each position in the sequence is a byte
with a value in the range 0x01..0xFF, which can
represent an ambiguity code, amino acid, or any other meaning you desire.
LASTZ does not try to interpret these in any way; it just aligns them as
abstract symbols corresponding to columns in the scoring matrix. Note that
the value 0x00 is prohibited.
The file itself is stored in a binary format described by the table below.
It can be written on either a big-endian or little-endian machine; LASTZ
determines the byte order of multi-byte fields by examining the magic number
at the start of the file.
Be sure to use the quantum action
in the file's sequence specifier to notify LASTZ that
it contains quantum DNA.
| File Offset | Data | Meaning |
0x00 |
C4 B4 71 97
—or— 97 71 B4 C4
|
Magic number indicating big-endian byte order.
Magic number indicating little-endian byte order. |
0x04 |
00 00 02 00 |
File conforms to version 2.0 of the Quantum DNA file format. |
0x08 |
00 00 00 14 |
Header length in bytes, including this field through the all-zero field. |
0x0C |
xx xx xx xx |
SOFF:
offset (from file start) to sequence data. |
0x10 |
xx xx xx xx |
NOFF:
offset (from file start) to name; 0 indicates no name. |
0x14 |
xx xx xx xx |
SLEN:
length of sequence data. |
0x18 |
00 00 00 00 |
Must be zero. |
NOFF |
… | Name: a zero-terminated ASCII string. |
SOFF |
… |
Sequence data:
a series of SLEN bytes, each of which is one quantum symbol
in the sequence.
|
This file is used with the quantum
action in a sequence specifier. It defines a mapping
from quantum DNA symbols to vectors of values for the
four nucleotides A, C, G, and
T. Usually these indicate the nucleotide probability distribution
for each symbol in the quantum alphabet. However, LASTZ doesn't interpret the
values, and only uses them to to augment the display of alignment blocks in the
Human-Readable Text output format.
Each line in the file gives the mapping for one symbol. Lines beginning
with a # are considered to be comments and are ignored, as are
blank lines. Data lines have five columns, separated by whitespace. The first
field contains the symbol, as either a single character or two hexadecimal
digits, while the remaining four fields contain values for
A, C, G, and T,
respectively. Each value can be either a single floating-point number or a
fraction (two floating-point numbers with a / between them,
without spaces). Any symbols in the quantum alphabet that aren't listed in
this file receive zeroes for all four values.
Here is an example.
# sym p(A|sym) p(C|sym) p(G|sym) p(T|sym)
01 0.125041 0.080147 0.100723 0.694088
02 0.111162 0.053299 0.025790 0.809749
03 0.065313 0.007030 0.004978 0.922679
... more rows here ...
FF 0.209476 0.014365 0.755682 0.020477
This file is used with the subset
action in a sequence specifier to select particular
sequences for processing. It consists of one sequence name per line. Lines
beginning with a # are considered to be comments and are ignored,
as are blank lines. Only the first whitespace-delimited word in any line is
read as the name; the rest of the line is ignored.
Note that when used in conjunction with a FASTA or 2Bit file, the names must appear in the same order as they appear in the corresponding sequence file, and must match the mangled name extracted from that file. When used with an HSX file, the names can be in any order but must match names indexed in the HSX file.
This file is used with the xmask and
nmask actions in a
sequence specifier. It consists of one interval per
line, without sequence names. Lines beginning with a # are
considered to be comments and are ignored, as are blank lines. Only the first
two whitespace-delimited words in any line are interpreted as the interval; the
rest of the line is ignored.
Each interval describes a region to be masked, and consists of
<start> <end>
Locations are one-based and inclusive on both ends (i.e., they use the
origin-one, closed position numbering system).
Note that the masking intervals are
counted along the forward strand, even if we are only
aligning to the reverse complement of the query specifier (i.e. for
‑‑strand=minus).
Here is an example. If the target sequence is hg18.chr1, this would mask the 5' UTRs from several genes. Note that the third column is neither required nor interpreted by LASTZ, and acts as a comment.
884484 884542 NM_015658
885830 885936 NM_198317
891740 891774 NM_032129
925217 925333 NM_021170
938742 938816 NM_005101
945366 945415 NM_198576
1016787 1016808 NM_001114103
1017234 1017346 NM_001114103
1041303 1041486 NM_001114103
This file is used with the ‑‑scores
option to specify a set of (mostly) scoring-related parameters en masse.
The score set consists of a substitution matrix and other settings. The other
settings come first and are individually explained in the
table below. All settings are optional,
and most of them have exact correspondence to command-line options and the same
defaults (unless otherwise specified in the table). Command-line settings
always override settings in this file. Any line may end with a comment
(# is the comment character).
In the matrix, rows correspond to characters in the target sequence, while
columns correspond to characters in the query. Matrix labels can be specified
either as single ASCII characters or as two-digit hexadecimal values in the
range 01..FF (do not add a leading 0x).
Note that the value 00 is not allowed.
The rows and columns of the matrix need not have the same set of labels, so
for example, a matrix might describe scoring between the 4-letter DNA alphabet
and the 15-letter ambiguity alphabet. Any labels other than A,
C, G, and T (or their hex equivalents)
are treated as quantum DNA. Score values can be
floating-point if the lastz_D version of the executable is used
instead of lastz.
Here is an example:
# This matches the default scoring set for BLASTZ
bad_score = X:-1000 # used for sub['X'][*] and sub[*]['X']
fill_score = -100 # used when sub[*][*] is not defined
gap_open_penalty = 400
gap_extend_penalty = 30
A C G T
A 91 -114 -31 -123
C -114 100 -125 -31
G -31 -125 100 -114
T -123 -31 -114 91
BLASTZ scoring files are also accepted. These only contain a substitution matrix, and row labels must be absent (they are assumed to be the same as the column labels). No other settings are allowed.
A C G T
91 -114 -31 -123
-114 100 -125 -31
-31 -125 100 -114
-123 -31 -114 91
| Keyword | Setting | Meaning |
bad_score |
<score><row>:<col>:<score>
|
This score fills a single row and column of the substitution matrix, so that
any occurrences of the corresponding characters are severely penalized. By
default the "bad" character for both the target and query is X
for DNA sequences or the null byte (00) for
quantum DNA sequences, and the associated score is
−1000.
This option allows you to change these characters and/or the score they receive.
The <row> and <col> fields are character codes (as explained
above); if they are absent |
fill_score |
<score> |
This is used as a default for all cells of the scoring matrix that are not
otherwise set (either by the user or by LASTZ's defaults). This is the score
used for Ns (unless
‑‑ambiguous=n is specified on the
command line).
The default value is −100. There is no corresponding command-line option. |
gap_open_penalty |
<penalty> |
This is identical to the <open> field of the
‑‑gap command line option.
|
gap_extend_penalty |
<penalty> |
This is identical to the <extend> field of the
‑‑gap command line option.
|
step |
<offset> |
This is identical to the
‑‑step command line option.
|
seed |
<strategy> |
This corresponds to the ‑‑seed and
‑‑transition command line options.
<strategy> must be one of the following, with no spaces:
12of19,transition
12of19,notransition
14of22,transition
14of22,notransition
|
ball |
<score><percentage>% |
This is identical to the
‑‑ball command line option.
|
x_drop |
<dropoff> |
This is identical to the
‑‑xdrop command line option.
|
hsp_threshold |
<score> |
This is identical to the
‑‑hspthresh command line option,
except that it does not currently support the
‑‑hspthresh=top<basecount> or
‑‑hspthresh=top<percentage>% variants.
|
y_drop |
<dropoff> |
This is identical to the
‑‑ydrop command line option.
|
gapped_threshold |
<score> |
This is identical to the
‑‑gappedthresh command line option.
|
When LASTZ is asked to infer substitution scores and/or gap penalties from the
input sequences (e.g. via the ‑‑infer
option), this file is used to set parameters that control the inference
process.
Here is an example (note that currently the parsing of this file is less
flexible than some of the others, and * is the only arithmetic
operator supported):
# base the inference on alignments in the middle half by identity
min_identity = 25.0% # 25th percentile
max_identity = 75.0% # 75th percentile
# scale scores so max substitution score will be 100, and only use
# alignments scoring at least as well as 20 ideal matches
inference_scale = 100 # max substitution score
hsp_threshold = 20*inference_scale
gapped_threshold = hsp_threshold
# allow substitution score inference to iterate at most 20 times;
# don't perform gap penalty inference -- instead hardwire gap penalties
# relative to max substitution
max_sub_iterations = 20
max_gap_iterations = 0
gap_open_penalty = 4*inference_scale
gap_extend_penalty = 0.3*inference_scale
# use all seedword positions (don't sample)
step = 1
# adjust for entropy when qualifying HSPs
entropy = on
min_identity and max_identity specify the range of
sequence identity upon which inference is based;
only alignment blocks within this range contribute to the inference. If the
value ends with a percent sign, it represents a percentile of the identity
distribution over all the blocks; otherwise it is a fixed percent identity
value. For example, min_identity=70 and
max_identity=90 indicates that blocks with identity ranging from
70 to 90 percent will be used, while min_identity=25% and
max_identity=75% indicates that half of the blocks will be used
(from the middle of the distribution).
The defaults are min_identity=0 and max_identity=100
(i.e., no blocks are excluded from inference due to percent identity).
inference_scale specifies a value for the largest substitution
score (i.e., the score for the best match). All other scores are scaled
proportionally. If this is set to none, the scores will be
log-odds using base 2 logarithms.
The default is inference_scale=100.
hsp_threshold and gapped_threshold correspond to
the command line ‑‑hspthresh and
‑‑gappedthresh options.
The defaults are hsp_threshold=3000 and
gapped_threshold=hsp_threshold.
max_sub_iterations and max_gap_iterations specify
limits on the number of inference iterations that will be performed. For
example, if you only want a substitution scoring matrix, you can set
max_gap_iterations=0.
The defaults are max_sub_iterations=30 and
max_gap_iterations=0.
gap_open_penalty and gap_extend_penalty correspond to
the command line
‑‑gap=[<open>,]<extend>
option. These are used for the first iteration of gap-scoring inference.
The defaults are gap_open_penalty=3.25*worst_substitution and
gap_extend_penalty=0.24375*worst_substitution.
step corresponds to the command line
‑‑step option. A large step, e.g.
step=100, could potentially speed up the inference process.
Ideally, this would base the inference on a sample of only one percent of the
whole. However, the sample actually ends up larger than that and is biased
toward HSPs that are either longer or have a lower substitution rate. This
happens because sampling occurs at the seed level, and such HSPs generally
have more seeds. Future versions of LASTZ may include a means to compensate
for this bias.
The default is step=1.
entropy corresponds to the command line
‑‑entropy option. Legal values are
on or off. If on, sequence entropy is incorporated
when filtering HSPs. The default is entropy=on.
The value of worst_substitution cannot be set directly.
Instead, it is computed from the initial scoring matrix. It is the minimum
score in the scoring matrix for any of the symbols A, C, G or T (equivalently,
the most negative score or the maximum penalty).
Note that these parameters apply to the inference process only. If the corresponding command line options are also set, those will apply for the final, "real" alignment stages (and will also override the inferred values if there is a conflict), but will not affect the inference itself. Inference cannot be used in conjunction with a scores file.
An HSX file is an index of sequences in other files, allowing fast random access to those sequences. The current implementation of LASTZ only supports indexing FASTA files. Future versions may include Nib and 2Bit sequences. The following is a brief overview of the file format. For more detailed information, see the HSX specification
An HSX file can be created using the build_fasta_hsx.py utility
(included in the tools directory of the LASTZ distribution), using
a command like this:
build_fasta_hsx sequences.fa [more_sequences.fa ...] > index.hsx
It is important that the HSX file has the extension .hsx and
resides in the same directory as the files being indexed. Further, the files
being indexed must have the extension .fa or .fasta.
These rules allow LASTZ to determine the sequence file type when it reads the
HSX file, and to locate the files containing the sequences.
The index file includes names to be used for the sequences, which do not have to match the original names or headers in the sequence files. This feature obviates the need for LASTZ to perform sequence name mangling, so most of those actions are not supported for HSX files. Instead, it is the responsibility of the program that creates the index to select suitable names.
A target capsule file is essentially a memory dump of several internal data structures related to the target sequence and the target seed word position table. At the present time the authors do not wish to create an official specification for this format, but please see Using Target Capsule Files for information on how to create and utilize them.
A segment file describes a list of segments representing gap-free alignments.
This list is either produced internally by LASTZ as a result of the
gap-free extension stage (see Overview), or read from
a user-supplied file via the
‑‑segments option. The latter
causes LASTZ to skip the indexing, seeding, and gap-free extension stages and
begin with the chaining stage (or the next specified stage, if chaining is not
requested).
The file contains two intervals per line, one from the
target and one from the query, with sequence names. Lines beginning with a
# are considered to be comments and are ignored, as are blank
lines. # can also be used to put comments at the end of lines.
Each line looks like
<name1> <start1> <end1> <name2> <start2> <end2> <strand2> [<score>] [#<comment>]
where <name1>, etc. correspond to the target sequence and <name2>,
etc. correspond to the query. Fields are delimited by whitespace.
Locations are one-based and inclusive on both ends, i.e. origin-one, closed (thus the interval "154 228" has length 75 and is preceded by 153 bases in its sequence). Negative strand intervals are measured from the 5' end of the query's negative strand (corresponding to the rightmost end of the given query sequence, i.e. counted along the reverse strand). All target intervals are on the positive strand. The two intervals must have the same length (since these alignments are gap-free). The score is used to determine the processing order during gapped extension. Segments without scores are given a score of zero.
Query sequence names must appear in the same order as they do in the query file.
For each query sequence, normally all positive strand intervals must appear
before any negative strand intervals.
Sequence names for the target may appear in any
order, and are only meaningful if the
multiple action is used; otherwise
they are ignored. Intervals with names not found in the target or query are not
allowed. In cases where sequence names are either unknown or of no importance
(e.g. when all sequences in the file have the same name), a * can
be used as a generic sequence name.
Here is an example.
R36QBXA37A3EQH 151 225 Q81JBBY19D81JM 14 88 + 6875
R36QBXA37D4L6V 26 100 Q81JBBY19D81JM 10 84 + 6808
R36QBXA37EVLNU 19 93 Q81JBBY19D81JM 7 81 + 6842
R36QBXA37CEBPD 8 81 Q81JBBY19D81JM 9 82 + 7108
R36QBXA37BLO6X 132 205 Q81JBBY19D81JM 11 84 - 7339
R36QBXA37A2W3P 162 214 Q81JBBY19D81JM 2 54 - 5024
R36QBXA37A9395 62 136 Q81JBBY19A323K 18 92 + 7231
R36QBXA37DNC74 18 82 Q81JBBY19A323K 2 66 + 6418
R36QBXA37CTR26 83 167 Q81JBBY19ASA7F 19 103 + 8034
R36QBXA37C2TAC 95 181 Q81JBBY19ASA7F 15 101 + 8272
LAV is the format produced by BLASTZ, and is the default. It reports the alignment blocks grouped by "contig" (chromosome, scaffold, read, etc.) and strand, and describes them by listing the coordinates of gap-free segments. This format is compact because it does not include the nucleotides, but consequently interpretation usually requires access to the original sequence files, and it is not easy for humans to read. LAV specification (same specification at PSU)
The option ‑‑format=lav+text adds
textual output for each alignment block (in the same
format as the ‑‑format=text option), intermixed with the LAV
format. Such files are unlikely to be recognized by any LAV-reading program.
AXT is a pairwise alignment format popular at UCSC and PSU. UCSC AXT specification
The option ‑‑format=axt+ reports
additional statistics with each block, in the form of comments. The exact
content of these comment lines may change in future releases of LASTZ.
MAF is a multiple alignment format developed at UCSC. The MAF files produced by LASTZ have exactly two sequences per block: the first row always comes from the target sequence, and the second from the query. UCSC MAF specification
The option ‑‑format=maf+ reports
additional statistics with each block, in the form of comments. The exact
content of these comment lines may change in future releases of LASTZ.
The option ‑‑format=maf- suppresses
the MAF header and any comments. This makes it suitable for concatenating
output from multiple runs.
SAM is a pairwise alignment format used primarily for short-read mapping, and supported by the SAMtools programming suite. This format is described in [Li 2009], and as of October 2009 a specification for it can be found at the SAMtools page at SourceForge.
For SAM files, LASTZ assumes that the target sequence is the reference and
that query sequence(s) are short reads. For alignments that don't reach the
end of a query, ‑‑format=sam uses
"hard clipping", while ‑‑format=softsam
uses "soft clipping". See the section on "clipped alignment" in the SAM
specification for an explanation of what this means.
The options ‑‑format=sam- and
‑‑format=softsam- suppress the SAM
header lines. This makes them suitable for concatenating output from multiple
runs.
CIGAR is an acronym for Concise Idiosyncratic Gapped Alignment Report, a
pairwise alignment format defined originally by the
Exonerate alignment program.
The format has since been adapted in different forms, as
ensembl cigar format
and as an
extended cigar string
in SAMtools. For
‑‑format=cigar, LASTZ implements
Exonerate CIGAR. LASTZ implements other CIGAR variants for
‑‑format=sam
and as fields for ‑‑format=general.
Exonerate CIGAR
format does not include nucleotides; instead it describes the locations of
indels (but not substitutions) using run-length encoding. An alignment is
characterized as runs of M (match and/or substitution),
I (query contains a base not in target), and D
(target contains a base not in query). Each run is encoded by the letter code,
whitespace, and the length; multiple runs are separated by whitespace. The
format also includes positional information for the start of the alignment. An
example is shown at the end of this
section. While there seems to be no complete, definitive specification for
CIGAR, the CIGAR files produced by LASTZ are believed to match the format
produced by Exonerate.
In the other variants of CIGAR, whitespace is removed and the order of the
letter code and length are reversed (length appears before letter code). In
some variants the length is omitted if it is 1; in other variants
M runs are divided into = (match) and X
(substitution). SAMtools extended cigar strings allow S and
H runs to describe clipping operations for short sequences.
LASTZ implements combinations of these variants where appropriate; details
are described in
‑‑format=general:cigar,
‑‑format=general:cigarx
and ‑‑format=sam.
To understand the differences between different types of CIGAR strings, consider the following alignment of a short 61-bp query to a longer target.
target: ...GATTAAGAGTCTGTCCGACCTTCTTCT---GGGTTTACCGAAGCCCACTTAGCTGATATTCGA...
||||||||||||||||X||||||| ||||||| X||||||||||||||||||
query: ACCTAAGAGTCTGTCCGACATTCTTCTACGGGGTTTA--TAAGCCCACTTAGCTGATAAGGTT
↑ 1 2 3 4 5 ↑ 6
0123456789012345678901234567890123456--789012345678901234567890
For ‑‑format=cigar, the alignment would be described by this line:
cigar: query 3 56 + target <start> <end> <strand> <score> M 24 I 3 M 7 D 2 M 19
For ‑‑format=general:cigar, the
alignment path would be described by this field:
24M3I7M2D19M
For ‑‑format=general:cigarx, the
alignment path would be described by this field:
16=X7=3I7=2DX18=
For ‑‑format=sam, the alignment path would
be described by this field:
3H24M3I7M2D19M5H
LASTZ's Differences format reports each difference between target and query on a separate line, where a difference is any indel or run of mismatches. It is intended for comparisons between close sequences, such as when comparing reads from a human individual to the human reference genome, or reads from a bacterial strain to a reference sequence for the same bacterium. The format is a tab-delimited table with one line per difference; it is well-suited for use with spreadsheets and the R statistical package.
The columns reported in this format are the name, start & end of the difference, strand, and overall size for the target; the name, start & end of the difference, strand, and overall size for the query; the text of the difference in the target, then in the query; and finally the text of the complete alignment block containing the difference, first in the target, then in the query. Intervals are origin-zero, half-open and counted along the forward strand.
The example below compares output in this format to similar results using the General output format for the same input sequences. For the Differences output, column numbers have been added for discussion (they are not in the actual output file). Each line in the output represents slight evidence that a mutation occurred changing the target sequence (chr22 here) to the query sequence (column 6). Columns 11 and 12 indicate the specific mutation that has putatively occurred. For example, the first line suggests that either an A has been inserted into chr22 at position 14485783, or an A has been deleted from EAYGRGI02GQ0SL at position 167 (actually, between positions 166 and 167). Note that there are three differences reported for EAYGRGI02GQ0SL, so it appears on three lines. The fifth line shows a putative SNP at chr22 position 15234401, with a C in the reference and a G in the read, while the seventh line shows evidence for an inversion of neighboring bases (AG vs. GA). Note that there are no lines for EAYGRGI01BIQCW, indicating a perfect match for that block (i.e., no differences).
Sample output for ‑‑format=differences.
(1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11)(12) (13) (14)
chr22 14485783 14485784 + 49691432 EAYGRGI02GQ0SL 167 167 + 303 A - TGAGA... TGAGA...
chr22 14485791 14485792 + 49691432 EAYGRGI02GQ0SL 174 174 + 303 A - TGAGA... TGAGA...
chr22 14485843 14485843 + 49691432 EAYGRGI02GQ0SL 225 226 + 303 - A TGAGA... TGAGA...
chr22 14731895 14731895 + 49691432 EAYGRGI01EAV19 228 229 - 298 - A CTTCT... CTTCT...
chr22 15234401 15234402 + 49691432 EAYGRGI02H5ZGS 99 100 - 180 C G CGAAT... CGAAT...
chr22 15255536 15255537 + 49691432 EAYGRGI01BTT7U 56 56 - 267 A - TTTGC... TTTGC...
chr22 15255552 15255554 + 49691432 EAYGRGI01BTT7U 71 73 - 267 AG GA TTTGC... TTTGC...
chr22 15255617 15255618 + 49691432 EAYGRGI01BTT7U 136 136 - 267 A - TTTGC... TTTGC...
chr22 15255624 15255625 + 49691432 EAYGRGI01BTT7U 142 142 - 267 A - TTTGC... TTTGC...
Sample output for
‑‑format=general:name1,zstart1,end1,strand1,size1,name2,zstart2+,end2+,strand2,size2,text1,text2.
chr22 14485616 14485920 + 49691432 EAYGRGI02GQ0SL 0 303 + 303 TGAGA... TGAGA...
chr22 14731668 14731964 + 49691432 EAYGRGI01EAV19 0 297 - 298 CTTCT... CTTCT...
chr22 15234302 15234482 + 49691432 EAYGRGI02H5ZGS 0 180 - 180 CGAAT... CGAAT...
chr22 15238845 15239070 + 49691432 EAYGRGI01BIQCW 0 225 - 225 TGGAA... TGGAA...
chr22 15255480 15255750 + 49691432 EAYGRGI01BTT7U 0 267 - 267 TTTGC... TTTGC...
(This example aligns reads from the genome of James Watson (available from NCBI's trace archive by querying for CENTER_NAME = 'CSHL' and CENTER_PROJECT = 'Project Jim') vs. the human reference genome hg18.)
This is a home-grown format designed to facilitate plotting the alignment
blocks with the R statistical package.
Alignments are reduced to a series of gap-free segments, each of which is
written in three lines as shown below. Endpoints are
origin-one, closed, and alignments on the reverse
strand have
<..._query_end> less than
<..._query_start> so that R will draw them in the reverse
(slope=−1) orientation.
<target_name> <query_name>
<segment1_target_start> <segment1_query_start>
<segment1_target_end> <segment1_query_end>
NA NA
<segment2_target_start> <segment2_query_start>
<segment2_target_end> <segment2_query_end>
NA NA
...
The file can then be plotted in R with commands like these:
dots = read.table("your_file",header=T)
plot(dots,type="l")
This textual output is intended to be read by people rather than programs. Each alignment block is displayed with gap characters and a row of match/transition characters, and lines are wrapped at a reasonable width to allow printing to paper. The exact format of this output may change in future releases of LASTZ, so programs are better off reading more stable formats like LAV, AXT, or MAF.
LASTZ's General format is a tab-delimited table with one line per alignment block and configurable columns. This format is well-suited for use with spreadsheets and the R statistical package.
The syntax for this option is:
--format=general[:<fields>]
where <fields> is a comma-separated list of field names in
the desired order, with no spaces. If this list is absent, the following
fields are printed, in this order:
score, name1, strand1,
size1, zstart1, end1,
name2, strand2, size2,
zstart2, end2, identity,
coverage.
The recognized field names are shown below. Positions (start and
end fields) are counted from the 5' end of the aligning strand,
unless otherwise indicated in the table.
Please see Interval Coordinates for more information
about the position numbering systems used in LASTZ.
The option
‑‑format=mapping is a shortcut for ‑‑format=general
with the following fields:
name1, zstart1, end1,
name2, strand2, zstart2+,
end2+, identity, coverage,
cigarx-.
The options
‑‑format=general-[:<fields>]
and ‑‑format=mapping- suppress column headers. This makes
them suitable for concatenating output from multiple runs.
| Field | Meaning |
score |
Score of the alignment block. The scale and meaning of this number will vary, depending on the final stage performed and other command-line options. |
name1 |
Name of the target sequence. |
strand1 |
Target sequence strand, either "+" or "−". |
size1 |
Size of the entire target sequence. |
start1 |
Starting position of the alignment block in the target, origin-one. |
zstart1 |
Starting position of the alignment block in the target, origin-zero. |
end1 |
Ending position of the alignment block in the target, expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems). |
length1 |
Length of the alignment block in the target (excluding gaps). |
text1 |
Aligned characters in the target, including gap characters.
align1 can be used as a
synonym for text1.
|
name2 |
Name of the query sequence. |
strand2 |
Query sequence strand, either "+" or "−". |
size2 |
Size of the entire query sequence. |
start2 |
Starting position of the alignment block in the query, origin-one. |
zstart2 |
Starting position of the alignment block in the query, origin-zero. |
end2 |
Ending position of the alignment block in the query, expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems). |
start2+ |
Starting position of the alignment block in the query, counting along the query
sequence's positive strand (regardless of which query strand was aligned),
origin-one.
Note that if strand2 is "−", then this is the other end of
the block from start2.
|
zstart2+ |
Starting position of the alignment block in the query, counting along the query
sequence's positive strand (regardless of which query strand was aligned),
origin-zero.
Note that if strand2 is "−", then this is the other end of
the block from zstart2.
|
end2+ |
Ending position of the alignment block in the query, counting along the query
sequence's positive strand (regardless of which query strand was aligned),
expressed either as origin-one closed or origin-zero half-open (the ending
value is the same in both systems).
Note that if strand2 is "−", then this is the other end of
the block from end2.
|
length2 |
Length of the alignment block in the query (excluding gaps). |
text2 |
Aligned characters in the query, including gap characters.
align2 can be used as a
synonym for text2.
|
nmatch |
Number of aligned bases in the block that are matches. |
nmismatch |
Number of aligned bases in the block that are mismatches (substitutions). |
ngap |
Number of gaps in the block, counting each run of gapped columns as a single gap. |
cgap |
Number of gaps in the block, counting each gapped column as a separate gap. |
diff |
Differences between what would be written for text1 and
text2. Matches are written as . (period), transitions
as : (colon), transversions as X, and gaps as
- (hyphen).
|
cigar |
A CIGAR-like representation of the alignment's path
through the
DP matrix. This is the short representation,
without spaces, described in the
Ensembl CIGAR specification.
For more information, see the section about CIGAR and its
|
cigarx |
Same as cigar, but uses a newer syntax that distinguishes matches
from substitutions and omits the run length when it is 1.
For more information, see the section about CIGAR and
its |
identity |
Fraction of aligned bases in the block that are matches (see
Identity). This is written as two fields.
The first field is a fraction, written as <n>/<d>.
The second field contains the same value, computed as a percentage.
|
continuity |
Rate of non-gaps (non-indels) in the alignment block (see
Continuity). This is written as two fields.
The first field is a fraction, written as <n>/<d>.
The second field contains the same value, computed as a percentage.
|
coverage |
Fraction of the entire input sequence (target or query, whichever is shorter)
that is covered by the alignment block (see
Coverage). This is written as two fields.
The first field is a fraction, written as <n>/<d>.
The second field contains the same value, computed as a percentage.
|
diagonal |
The diagonal of the start of the alignment block in the
DP matrix, expressed as an identifying number
start1-start2.
|
shingle |
A measurement of the shingle overlap between the target and the query. This is intended for the case where both the target and query are relatively short, and their ends are expected to overlap. |
LASTZ includes support for other output formats which are intended mainly for the convenience of the developers. If you have specific questions, please contact us.
The biological research community has established several competing standards describing intervals on a strand of DNA. Different programs often use different standards. Since LASTZ supports several input and output formats, it is inevitable that it uses more than one way of describing an interval. We describe the different conventions here.
For this discussion, suppose we have a 50-nucleotide strand of DNA as follows:
origin-one, closed: 12345678901234567890123456789012345678901234567890
↓ ↓
5' >>> CGACCTTACGATTACCTACTTAACACGTAAACTGAGGGATCAAAAGGAAA >>> 3'
↑ ↑
origin-zero, half-open: 01234567890123456789012345678901234567890123456789
Note that since this is DNA it has 5' and 3' ends;
we assume that all input sequences follow the standard practice of listing the
bases with the 5' end on the left.
Here we've highlighted the subsequence ATTACCTA so we can
discuss how to describe the interval it occupies. There are two commonly used
ways to do this. Both count from 5' to 3' (left to right). One way,
origin-one, starts counting from one. The other way,
origin-zero, starts counting from zero. So in origin-one,
ATTACCTA begins at position 11, while in origin-zero it begins at
position 10.
To describe the ending position, there are also two commonly used methods.
One way is closed, in which the position of the last nucleotide is
given. The other is half-open, in which the position following the
last nucleotide is given. These are theoretically independent of the
conventions for the origin, but in practice only two of the combinations are
commonly used: origin-one, closed and
origin-zero, half-open. In the former, ATTACCTA is
said to occupy the interval (11,18), while in the latter it is said to occupy
the interval (10,18). Notice that only the first number changes between these
two paradigms; the second number stays the same.
Another factor to consider is that DNA is usually double stranded, which would look like this:
along forward: 12345678901234567890123456789012345678901234567890
↓ ↓
forward strand: 5' >>> CGACCTTACGATTACCTACTTAACACGTAAACTGAGGGATCAAAAGGAAA >>> 3'
complement strand: 3' <<< GCTGGAATGCTAATGGATGAATTGTGCATTTGACTCCCTAGTTTTCCTTT <<< 5'
↑ ↑
along reverse: 09876543210987654321098765432109876543210987654321
In some cases it makes sense to refer to the interval along the complement
strand. For example, if the above sequence was a query and the target
contained TAGGTAAT, how should the query position of an alignment
of those two be described? One way would be to still refer to the interval
along the forward strand (which we also call the plus or
positive strand), and just indicate that in fact it was the reverse
complement of that interval that aligned. We call this
counting along the forward strand. Another way is to count from the
other end, from the 5' end of the complement strand (which we also call the
reverse, minus or negative strand). We call
this counting along the reverse strand, and for clarity we might add
"from its 5' end". In this example, if we were using origin-one, closed
counting, we would say that TAGGTAAT occurs at (33,40) along the
reverse strand.
Unless noted otherwise (e.g. for the
R Dotplot output format), when counting along the
forward or reverse strand LASTZ swaps the interval's endpoints if necessary, so
the position called start is numerically ≤ the position called
end. This is a common convention, but there are other programs
that leave them unswapped.
Note that when counting positions all characters in the sequence are counted,
including runs of Ns or Xs and even invalid
characters. This is important so that other programs can use the reported
positions to index directly into the original sequences.
The handling of characters other than A, C,
G, and T in sequences that are supposed to represent
DNA is problematic.
In ordinary (non-quantum) DNA sequences, LASTZ currently supports two of these,
N and X. They can either be present in the original
input file (except that the Nib and
2Bit formats are incapable of containing
Xs), or added by using an
xmask or
nmask action in the
sequence specifier.
LASTZ can also be configured to tolerate the other IUPAC-IUB ambiguity codes.
Many database sequences contain Ns to represent bases for which
the actual nucleotide is not known (at least, not known with any level of
confidence). Ns (or better, Xs) can also be used to
mask out regions that have previously been identified as being of no interest,
and therefore should not be aligned. And unfortunately, there is also a
tradition of using strings of Xs or Ns to splice
together multiple sequences to gain efficiency when dealing with programs that
were limited to operating on a single sequence.
Although splicing was useful in BLASTZ, it is no longer needed for LASTZ.
Since LASTZ can handle multiple target sequences (via the
multiple action in the target
file's sequence specifier), it is preferred that users not resort to
splicing. However, replacing BLASTZ with LASTZ in an existing pipeline may
still involve spliced sequences, so LASTZ's default interpretation of non-ACGT
characters is the same as BLASTZ's:
Xs are excluded from the alignment seeding stage, and are so
severely penalized by alignment scoring that they will not normally appear in
any alignment. Ns are also excluded from seeding, and are
penalized about the same as a transversion mismatch. Specifically, any
substitution with X is scored as −1000, and any substitution
with anything else (other than A, C, G,
or T) is scored as −100.
Note that you have to put "enough" Xs or Ns between
the sequences so that no alignment block will cross the splice. This can be
tricky, since gap scoring is only dependent on the length of the gap and not on
the characters in the gap. So if a gap the same length as the splice is not
penalized more than the y-drop setting, the
alignment may hop the splice. As a rough guideline, a splice length of 50 is
usually enough with the default settings, but this is not guaranteed.
This default treatment of non-ACGT characters also works well when
Xs or Ns are used to mask out
regions that should not be aligned. However, it is inappropriate when the
sequences contain Ns to represent ambiguous bases. To handle this
case, LASTZ provides the ‑‑ambiguous=n
option, which causes substitutions with N to be scored as zero.
Additionally, the ‑‑ambiguous=iupac option
causes the other IUPAC-IUB ambiguity codes (B, D, H, K, M, R, S, V, W,
Y) to be treated this same as an ambiguous N.
In either case, non-ACGT characters are ignored during the seeding stage.
Only seed words that consist entirely of A, C,
G, and/or T are involved in seeding, even if the
non-ACGT characters occur in "don't-care" positions in the seed pattern.
The score values described above can be changed if a
scoring file is specified. The −1000 score
is called bad_score and the −100 score is called
fill_score. Further, which character is considered "bad" (by
default this is X) can also be specified in the scoring file, and
can actually be different between the target and query. Throughout this
document, when we refer to the character X appearing in a DNA
sequence, we generally mean the character specified as "bad", which defaults to
X.
Quantum DNA sequences are different: they use an
arbitrary, user-defined alphabet of symbols, so the above-mentioned special
treatments for N and X do not apply. The default
"bad" character for quantum sequences is the null byte (00
hexadecimal), which is not even allowed in the sequence; however it can be
changed to one of the valid alphabet symbols via the scoring file. There is
no analog of ambiguous Ns for quantum sequences, as typically
every symbol has some level of ambiguity.
Often the names in the input sequence files are inconvenient for downstream processing, or create problems with certain output formats. This is further complicated by the fact that some input formats (most notably Nib) do not contain sequence names, so in those cases a name must be derived from the filename. LASTZ provides several choices for naming the input sequences. These alternatives are mutually exclusive; only one can be used at a time for a particular input file.
Internally, LASTZ handles the naming task in two phases. First, it creates a full header for the sequence. If the input format provides a name or header, that becomes the full header. Otherwise, the full header is constructed from the file name.
In the second phase, LASTZ shortens the full header to a nickname. If the full
header starts with a file name, any path prefix is removed, and commonly-used
file extension suffixes are also removed (.fa, .fasta,
.nib, .2bit). Then by default, LASTZ uses the first
word (composed of characters other than whitespace, vertical bar, or colon) of
the remaining string as the sequence name. Thus a
FASTA header like
"> ~someuser/human/hg18/chr1.fa Human Chromosome 1"
is shortened to simply chr1.
The actions
nameparse=darkspace
and nameparse=alphanum in the
sequence specifier change how the first word is
determined. darkspace
(i.e., "non-whitespace") narrows the set of terminating characters
to allow vertical bars and colons to appear in the word, while
alphanum widens it so the word is restricted to only alphabetic,
numeric, and underscore characters. Path prefixes
and file extensions are still removed.
The default shortening is often adequate. For example, consider the following
FASTA file. By default, the names will be 000007_3133_3729 and
000015_3231_1315.
>000007_3133_3729 length=142 uaccno=FX9DQEU13H5YZN
ACCCGAAAGAGAAACAGCTTCCCCCCCTGTCCCGAGGGATATCAAGTAGTTTGTTGGCTA
GGCTGATATTGGGGCCTTCCGCTAGAGTCGGCGCCCGCGCCTACGAGTCCCCCCCACCCC
CCACCCCCACAGCGGGTTATCC
>000015_3231_1315 length=190 uaccno=FX9DQEU13HUTXE
TTGTTGAGTCGGATGAGAATAGCAAGTGCAGTCAACGGCAATGTGCTGGGTTAGTACAAC
...
However, the user may find it more convenient to use the accession numbers. To
accomplish this, she can use the
nameparse=tag:uaccno= action. LASTZ
will look for the tag string uaccno= in each header and read the
name from the characters that follow it, up to the first character that is not
alphabetic, numeric, or an underscore. In this case the sequence names would be
FX9DQEU13H5YZN and FX9DQEU13HUTXE. If the tag string
is not found in the full header for a particular sequence, the default
shortening is used instead.
Now consider this FASTA file:
>gi|197102135|ref|NM_001133512.1| Pongo abelii ...
GCGCGCGTCTCCGTCAGTGTACCTTCTAGTCCCGCCATGGCCGCTCTCACCCGGGACCCC
CAGTTCCAGAAGCTGCAGCAATGGTACCGCGAGCACGGCTCCGAGCTGAACCTGCGCCGC
...
>gi|169213872|ref|XM_001716177.1| PREDICTED: Homo sapiens ...
ATGTCTGAGGAGGTAGGATTTGATGCAGGAGGGAGGATCTGGTGCACTTATAAGGATCTG
GGTCTGTCAGTGTCAGAGAAGGTAGGATCTGGCCCTGGTATGAGGATCTGGATCTGTCAG
...
>gi|34784771|gb|BC006342.2| Homo sapiens ...
GGGTGGGAGGACGCTACTCGCTGTGGTCGGCCATCGGACTCTCCATTGCCCTGCACGTGG
GTTTTGACAACTTCGAGCAGCTGCTCTCGGGGGCTCACTGGATGGACCAGCACTTCCGCA
...
In this case the default action does not do what we want (all sequences would
be named gi). The action nameparse="tag:gi|" gives
us the names 197102135, 169213872, and
34784771. (Note the quotes; this is necessary to prevent the
command-line shell from interpreting | as a pipe character.)
Observe that a tag of ref| will not work, because the third
sequence would need gb| instead.
Sometimes it is more convenient just to assign a specific name. This can be
done with the
nickname=<name>
action. For example, using the target and query file specifiers
~someuser/human/hg18/chr1.nib[nickname=human] and
~someuser/human/ponAbe2/chr1.nib[nickname=orang], the output
will show the sequences as human and orang rather
than calling them both chr1.
If <name> contains the substring {number},
the nickname will contain the number of the sequence within the file. This is
particularly useful when there is more than one sequence in the file.
If you want to do away with name mangling entirely, you can use the action
nameparse=full. This uses the full
header as the sequence name. But note that if it contains spaces, the
resulting alignment files may not be readable by downstream tools.
The above discussion applies to ordinary DNA sequences in FASTA, Nib, or
2Bit format. HSX index files
are handled differently: by default LASTZ uses the name from the index as-is,
without shortening it,
and the various nameparse actions are not
allowed. The nickname action can be used,
but is generally not
necessary since you can store the names you want directly in the index.
Note that if the
subset=<names_file> action is
used, the names in the <names_file> must match the mangled
(or indexed) names.
For FASTA files, more complicated name mangling can be performed using standard
Unix command-line tools. In the second example above, we could pipe the input
through sed a couple times to shorten each name to the NCBI
accession numbers NM_001133512.1, XM_001716177.1,
and BC006342.2.
cat query_file.fa \
| sed "s/>.*ref\|/>/g" \
| sed "s/>.*gb\|/>/g" \
| lastz target /dev/stdin
Seeds are short near-matches between the target and query sequences, where "short" typically means less than 20 bp. Early alignment programs used exact matches (e.g. of length 12) as seeds, but spaced seeds can improve sensitivity when the sequences are diverged.
A spaced seed pattern is a list of positions, in a short word, where
a seed may contain mismatches. For example, consider the seed pattern
1100101111. A 1 indicates a match is
required in this position, and a 0 indicates a mismatch is allowed
(effectively it is a "don't care" position). As the example below shows, using
this seed pattern, the seed word GTAGCTTCAC hits twice in the
sequence ACGTGACATCACACATGGCGACGTCGCTTCACTGG.
target: ACGTGACATCACACATGGCGACGTCGCTTCACTGG
(mis)match: ||XX|X|||| ||X|||||||
query: GTAGCTTCAC GTAGCTTCAC
pattern: 1100101111 1100101111
Spaced seeds have been shown to be more sensitive than exact match seeds, with little change in specificity. This is most advantageous when the sequences have lower similarity, such as human vs. mouse or chicken. Which seed pattern is best depends on the sequences being compared. See [Buhler 2003] for a discussion of spaced seeds and how to design them.
LASTZ's seeding options give the "user" many choices. The intent is that these will be selected by some program (hence the quote marks around "user"), but they are available from the command line for anyone.
--seed=match<length>
1s, 0s, and Ts, where a 1
indicates that a match is required in that position, a 0 indicates
that a mismatch is allowed, and a T indicates that a mismatch is
allowed only if it is a transition (A↔G or C↔T).
--seed=<pattern>
The default seed is ‑‑seed=1110100110010101111, which is the same
12-of-19 seed used as the default in BLASTZ.
0s and Ts, it is
implemented internally as a half-weight seed, which uses much less memory
(the same amount as a normal seed pattern half as long). Additionally,
‑‑seed=half<length> can be used as shorthand to specify a
space-free half-weight seed (i.e., all Ts).
1 in a spaced seed, or any
position in an N-mer match) is allowed to be a transition instead of a true
match. ‑‑notransition disables this. Alternatively,
‑‑transition=2 allows any two match positions to be
transitions.
‑‑filter option imposes additional requirements on the number
of transversions and matches in a valid seed. This is especially useful in
conjunction with half-weight patterns. For example,
--seed=TTT0T00TT00T0T0TTTT --filter=2,15
specifies the same pattern as the default seed, but allows the twelve
T positions to be matches or transitions, requires at least
fifteen matches total (among the 19 positions), and allows at most two
transversions. Note that the transversions can only occur in the
0 positions, since the T positions allow only matches
or transitions.
And although there are seven 0 positions, five of
them must contain matches or transitions since only two transversions are
allowed.
--twins=[<minsep>..]<maxsep>
The distance between the hits (the number of bases between the end of the
first hit and the beginning of the second) must be at least
<minsep> but not more than <maxsep>.
If <minsep> is omitted, zero is used (which means the
twin seeds may be adjacent but not overlap). Negative values can
be used; for example ‑‑twins=‑5..10
means the twins can overlap
by as much as 5 bases or can have as much as 10 bases between them.
Sometimes, the only answer you want from an aligner is whether a query has any strong alignments to the target or not. For example, you may want to know which reads in a sequencing run have no alignment with a reference genome. In this case, if a read aligns to a thousand different places on a particular chromosome, you aren't interested in learning where — all you want to know is whether it aligned or not.
The ‑‑anyornone option is designed
for such cases, and can significantly improve alignment speed. Once any
qualifying alignment has been found, processing for the current query is
halted. The alignment is reported to the output, and then we immediately begin
processing the next query. A qualifying alignment is one that would normally
be output given the other parameter settings; for example it satisfies the
scoring thresholds (‑‑hspthresh
and/or ‑‑gappedthresh) and any
back-end filters.
To get a list of reads that have at least one "good" alignment with a reference sequence, you could do something like this:
lastz <reference> <reads> --anyornone \
--step=10 --seed=match12 --notransition --exact=20 --noytrim \
--match=1,5 --ambiguous=n \
--coverage=90 --identity=95 \
--format=general:name2
This option slightly changes the usual processing order described in the Overview. Instead of performing gap-free extension on all seeds, collecting them into a list of HSPs, and then performing gapped extension, each HSP is gap-extended and back-end filtered immediately. This avoids wasted work to perform complete early stage processing on hits that will just be abandoned as soon as the first qualifying alignment is found.
The default configuration of gapped extension in LASTZ is to end the alignment where the score would be the highest. This means that any prefix or suffix of the alignment will have a non-negative score. While this is appropriate for alignments that lie somewhere in the middle of two long sequences, it is not desirable when an alignment is near the end of one or both sequences, which happens quite often when aligning short reads.
Consider the following alignment of a 50-base query to a chromosome target, and
suppose we are using ‑‑match=1,5,
‑‑gap=6,1,
‑‑identity=97, and
‑‑coverage=95. The entire
alignment as shown has 97.9% identity (46/47) and 100% coverage. However, the
first five bases (AGAAC vs. AGAAG) have a negative
score: four matches at +1 each and one mismatch at −5 gives a score
of −1 for this prefix. The highest scoring alignment is from positions
6 through 50, for a score of 33 (the entire alignment scores only 32). If
we stop the alignment at the highest score, coverage drops to 90%, and the
alignment is discarded. The overall result is that we will discard reads that
we don't want to, and we will see a bias against mismatches near the ends of
reads. (Note that this anomaly arises because the alignment is terminated
abruptly by the end of the sequence rather than normally by a low-scoring
region; also the ‑‑coverage option is more commonly used with
short reads than with longer sequences.)
target: ... CTTAGAACGGTAGATACTTGTATAAT---CGAGGGGGTTATTTTGTACAAATGACT ...
||||X|||||||||||||||||| ||||||||||||||||||||||||
query: AGAAGGGTAGATACTTGTATAATCAACGAGGGGGTTATTTTGTACAAATG
↑ ↑
12345678901234567890123456789012345678901234567890
To avoid this behavior, use the
‑‑noytrim option when aligning short
reads. This causes LASTZ to refrain from trimming such alignments back to the
highest-scoring location. Specifically, if the
gapped extension process encounters the end of the
sequence, it will keep that as the end of the alignment. In this case a
negatively-scoring prefix or suffix will be kept as long as it does not score
worse than the ‑‑ydrop value.
In some applications, e.g. when assembling reads into contigs, we want to
determine how sequence ends overlap each other. For example, in case 1 below,
the start of the query overlaps the end of the target by 30 bases,
and both sequences extend beyond each other in opposite directions. We call
this situation "shingling"
(like shingles on a rooftop), and the shingle field of the
General output format provides a measurement of it.
A positive value indicates that the start of the query overlaps the end of the
target (case 1), while a negative value indicates the roles are reversed
(case 2). If neither of these cases occurs
(e.g. if either sequence fails to
extend beyond the other), an NA is reported.
Case 1 (shingle = +30):
end
↓
target: ... GACGGCGGCTAACACATTGTGTTGXACGTACCATAACCAA
||||||X|||||||||XX||X||||||
query: AACACAGTGTGTTGCAACTATCATAACATTAAACTTTAGA ...
↑
start
Case 2 (shingle = −30):
start
↓
target: TCCCTAATAAATCTTAAGTGCGATCCGCAGCGAGGTGTAC ...
||||X|||||||||X||||||||X||
query: ... TGGCGCCTGTAGTCTAAGAAATCTTAATTGCGATCCACAC
↑
end
Note that the value reported has no relation to the number of bases that align in that region, nor is it an indication that the alignment extends all the way to the start or end of the sequences. The shingle value is just evidence that the proper registration of the two reads is to overlap them by the given value — information that an assembler might use in assembling those reads into a contig.
Target capsule files are provided to improve run-time memory utilization when multiple CPU cores on the same computer are running LASTZ with the same target sequence. They permit the lion's share of the large internal data structures to be shared between the processes. This allows more copies of LASTZ to be run simultaneously with less physical memory, which can improve the throughput, for example, when mapping a large set of reads to a single (large) reference sequence.
To create a capsule file, use a command like this:
lastz <target> --writecapsule=<capsule_file> [<seeding_options>]
Applicable seeding options are
‑‑seed,
‑‑step,
‑‑maxwordcount,
and ‑‑word.
To use the capsule file, run LASTZ like this:
lastz --targetcapsule=<capsule_file> <query> [<other_options>]
No additional effort on the part of the user is required to handle sharing of
the capsule data between separate runs. Nearly all options are allowed;
however the seeding options
‑‑seed,
‑‑step,
‑‑maxwordcount,
and ‑‑word
are not allowed, since these (or their byproducts) are already stored in the
capsule file. Further, ‑‑masking
is not allowed, because it would require modifying both the target sequence and
the target seed word position table, which are contained in the capsule.
Internally LASTZ asks the operating system to directly map the capsule file
into the running program's memory space
in a read-only fashion. Multiple running instances can map
the same file; each instance will have its own virtual addresses for the
capsule data, but the physical memory is shared. There is no requirement for
more than one instance to actually use the capsule simultaneously. Running
a single copy of lastz with ‑‑targetcapsule will work
fine, and in fact there may be a small speed improvement compared to running
the same alignment without a capsule.
The downside of this technique is that the capsule files are very large and are also machine-dependent. For example, the file for human chromosome 1 is about 1.4 Gb. Note that attempts to run a capsule built on a mismatched computer are detected and rejected.
Scoring inference is an automated method for determining appropriate substitution scores and/or gap penalties directly from the sequences being aligned. The resulting scoring parameters can be saved to a file and/or used immediately to align the sequences. Generally these depend mostly on the species rather than particular regions, so once a suitable scoring set has been obtained for a pair of species, the inference does not need to be performed for each alignment run. In this section we give a brief overview of the inference process; see [Harris 2007] for a more detailed description.
Inference is achieved by computing the probability of each of the 18 different alignment events (gap open, gap extend, and 16 substitutions). These probabilities are estimated from alignments of the sequences. Of course, at first we don't have alignments, so we start by using a generic scoring set to create alignments, infer scores from those, then realign, and so on, until the scores stabilize or "converge". Ungapped alignments are performed until the substitution scores converge, then gapped alignments are performed (holding the substitution scores constant) until the gap penalties converge.
To have LASTZ infer scoring parameters, use
a suitably enabled build of LASTZ (see below), and specify
the ‑‑infer or
‑‑inferonly options. (The latter
will stop after inferring the parameters, without performing the final
alignment.) Settings for the inference process can be specified in a
control file included with these options.
The ‑‑infscores option causes the
inferred scoring parameters to be written out to a separate file. If no
<output_file> is specified, it is written to the header
of the alignment output file, as a comment. As a last resort, if no alignment
is performed the scoring set is written to stdout. The parameters
are written in the same format used to input scoring
sets.
Usually it is undesirable to use all alignment blocks for inference. Blocks with a high substitution rate (low identity) are likely to be false positives. On the other hand, blocks with few substitutions (high identity) will be found regardless of what scoring parameters are used. Thus it is desirable to base the inference only on statistics from a mid-range of identity. By default the middle 50% is used (that is, the 25th through 75th percentile from the identity distribution), but this can be changed in the control file.
lastz_D). Moreover,
the technique used to infer gap penalties has not yet been shown to select good
values, so the author recommends that users only employ inference for
substitution scores. To encourage these recommendations, the scoring inference
code is blocked from operation in the integer scoring version of LASTZ
(lastz), and gap penalty inference is blocked in both versions.
Special build options are available to defeat the blocks; contact the author
if you are interested.
‑‑allgappedbounds option can be
used to revert to the bounding criteria used in BLASTZ.
During the gapped extension stage, LASTZ processes the anchors in order of score (highest scoring anchor is extended first, and so on). As anchors are extended, a list of bounding alignments is constructed. These correspond to paths in the DP matrix. Bounding alignments created for higher-scoring anchors are used to bound the possible DP paths that lower-scoring anchors can take. This prevents alignments from crossing each other.
In BLASTZ, every gapped extension became a bound, and this was originally the default behavior in LASTZ, through release 1.1.52. However, this caused LASTZ to miss some alignments which it should have found. The failure case occured as follows. A high-scoring anchor is extended but fails to meet the score threshold. But it gets added as a bound. Then the extension of a lower-scoring anchor is prevented from crossing or intersecting with that path, and it too gets discarded even though it might score highly enough. This could occur, for example, when two extensions would (in the absence of each other) share the same tail, and the higher-scoring of the two has a lower-scoring anchor.
The correction for this is to only use alignments as bounds if they satisfy the
score threshold. This corrected behavior is now the default in LASTZ (as of
release 1.02.00). The
‑‑allgappedbounds option can be
used to revert to the bounding criteria used in BLASTZ.
Bellman R (1957). Dynamic Programming. Princeton University Press, Princeton, NJ.
Buhler J, Keich U, Sun Y (2003). Designing seeds for similarity search in genomic DNA. Proc. 7th Annual International Conference on Research in Computational Molecular Biology (RECOMB '03), pp. 67-75.
Chiaromonte F, Yap VB, Miller W (2002). Scoring pairwise genomic sequence alignments. Pacific Symposium on Biocomputing, vol. 7, pp. 115-126.
Gusfield D (1997). Algorithms on strings, trees and sequences. Cambridge University Press, Cambridge, p. 244.
Harris RS (2007). Improved pairwise alignment of genomic DNA. Ph.D. thesis, Pennsylvania State University.
Li H et al. (2009). The Sequence Alignment/Map (SAM) format and SAMtools. Bioinformatics 25:2078-2079.
Myers EW, Miller W (1989). Approximate matching of regular expressions. Bull. Math. Biol. 51:5-37.
Zhang Z, Berman P, Miller W (1998). Alignments without low-scoring regions. J. Comput. Biol. 5:197-210.
Bob Harris and Cathy Riemer